[Via Pharyngula] I would’ve thought Ben Stein would’ve been smarter than to get involved with something like this. (*Although, after looking up Ben Stein’s politics, it’s clear that he’s very right-wing.) He’s narrating a pretend documentary about how “Big Science” is unfair to the theory of Intelligent Design.
According to a Beliefnet blog:
Not set for release until February, the buzz campaign has already started for this unabashedly Michael-Moore-style, in-your-face documentary. Narrated by Ben Stein–best known for giving his money away and slowly repeating the name “Bueller” from the front of a classroom to hilarious effect–”Expelled” aims to expose the stifling of debate in this country about the origins of life and make the case for the validity of Intelligent Design.
Yesterday, I attended a presentation to drum up advance support for the film. It was led by Paul Lauer–a Christian marketing maven best known for helping make “Passion of the Christ” the blockbuster it was–and one of the film’s co-producers, a man identified only as Logan, who bore a striking resemblance to Ned Flanders incarnate, albeit tanner (and, being a huge Flanders fan, I mean that as a compliment). The purpose was to win over Christians influential in their communities, to make this a must-see, a film to which they’ll preach about, gab about, and bring their friends, family, churches, non-Christian friends, etc. etc.
Let the buzz begin. Not that “Expelled’s” intentionally incendiary tone will need much help from the pastors and religious-school teachers in attendance at yesterday’s meeting. From the clips and trailers they showed, the film presents a world of–to use a quote I heard repeatedly yesterday–”the new scientific movement” (Intelligent Design, in case you weren’t sure) vs. the tired, old “theory” of evolution. Relying on news-clip montages, interviews, even cut-away shots of concentration camps, “Expelled” talks of faithful scientists and other believers losing jobs, losing grants, even losing friends in defense of ID. And, relying on footage of Richard Dawkins, Sam Harris, and other atheists du jure, it sets up a worldview of ID vs. atheism, with no gray areas in between.
And, taking it even further, it posits that, without God, there can be no source of morality, no reason not to “stab someone on the subway,” to borrow another phrase I heard a couple of times yesterday (and which explained, according to Lauer and Logan, the concentration camp scenes, since the film will explore the influence of Darwinism on Hitler). So the battle for ID to be taught on par with evolution is no more, no less than a battle for the legitimacy of morality itself.
These truthy documentaries seem to have become quite a trend in modern America. I have yet to see one that was actually honest, despite all the work they did to try to appear that way. (I found Moore’s Bowling for Columbine and Control Room to be full of spin – not that FOX News is one bit better.) I fully expect this movie to play up it’s truthiness while moves towards a predefined message that it wants people to believe.
Not surprisingly, the movie seems to eschew actual scientific discussion of Intelligent Design, preferring to play-up the victimization of ID advocates (a common and exaggerated claim). I’m sure they’ll avoid talking about the victimization of evolutionists by creationists overseas — or the fact that the (creationist) Kansas Board of Education invited Adnan Oktar, who was behind the attacks, to talk to them. Rather than taking about the mechanisms of evolution, they chose, instead, to talk about the “evils of evolution”: show concentration camps and talk about Adolf “God with Us” Hitler – so they can emotionally inflame people, shutting down the thinking portions of their brains, rather than intellectually convert them. No doubt, they’ll avoid mentioning Martin “We are at fault in not slaying [the Jews]” Luther’s influence on Hitler – whom Hitler praised in his book, Mein Kampf. Meanwhile, Origin of the Species was banned in Nazi Germany.
Speaking of which – there’s something about “Social Darwinism” and eugenics that strikes me as an odd criticism of evolution. Many creationists will say that they believe in “microevolution”, but not “macroevolution”. I’ve also heard creationists claim that when humans chose which animals to breed together (for example, to make a new breed of dog), that it’s an example of Intelligent Design, not evolution (which relies on natural selection – not human selection). The ideas of Social Darwinism and eugenics requires only that microevolution is true (something that creationists, themselves, believe in), and eugenics relies on human choice (making it a branch of Intelligent Design, according to their argument). Whether you believe in “macroevolution” or not, makes no difference to either Social Darwinism or eugenics. (Which makes it unsurprising when we find pro-eugenics Creationists.) It would be nice if Creationists would actually acknowledge the fact that Social Darwinism and eugenics isn’t strengthened by a belief in “macroevolution”. But, for political reasons (i.e. mudslinging), they’ll never admit the fact – it’s too important for keeping the sheep in line.
Update: PZ Myers, who is in the movie, talks about the video shoot he did for them. They said he did an interview for a documentary called “Crossroads: The Intersection of Science and Religion”. It’s not uncommon for films to have working titles that get changed – although it certainly opens up the endless possibilities to misrepresent the spin they’re going to put on the movie. In an apparent move to hide the direction of the movie, the blurb at the film studio merely states:
Crossroads – The Intersection of Science and Religion:
It’s been the been the central question of humanity throughout the ages: How in the world did we get here? In 1859 Charles Darwin provided the answer in his landmark book, “The Origin of the Species.” In the century and a half since, biologists, geologists, physicists, astronomers and philosophers have contributed a vast amount of research and data in support of Darwin’s idea. And yet, millions of Christians, Muslims, Jews and other people of faith believe in a literal interpretation that humans were crafted by the hand of God. This conflict between science and religion has unleashed passions in school board meetings, courtrooms and town halls across America and beyond.
That summary certainly doesn’t show an obvious bias. On the other hand, the website for “Expelled” puts a much more obvious spin on things:
All over the world, Big Science is on the march, making sure that Neo-Darwinian Materialist Theory is protected, and that any challenges and challengers are dealt with…properly.
Science is too important to be left in the hands of just any scientists, no matter how “credentialed” they may be!
Which is why the administration at Big Science Academy thought it essential that students be made acutely aware of what happens to “dissenters” who stray into dangerous areas of science after graduation.
Our Science “Field Trip” allowed Science Club students to travel around the world, and to see first-hand what happens to “the expelled” when they attempt to “follow the evidence wherever it leads.” (Link)
Interesting to see how these games get played.
I also noticed that Ben Stein has a blog post up at the movie’s website. Expecting my comment to be moderated, I attached this comment:
Hi Ben. I was just wondering if someone is moderating this blog. And, if so, do you think it is hypocritical to argue for free speech, but prevent critical comments from showing up on this blog?
“Your comment is awaiting moderation.” Yup. Not surprising in the least.
(Update: My comment, along with about 200 others, was approved within 24 hours of my post. Last I checked, there were over 900 comments. On a cursory read over the first hundred or so, none in particular stood out. Yes, you can tell Ben Stein he is wrong, but that’s certainly not going to change his mind. Most of the comments didn’t seem to have much in the way of useful arguments against his position.)
See also:
Church of the Designer Who Shall not be Named
Creationist Censorship – WordPress and Turkey
Update: I have been instructed by the shadowy network of atheist bloggers to provide this link to Expelled.

Just a little correction. Adnan Oktar didn’t testify in Kansas, Mustafa Akyol did. It appears Akyol was Oktar’s spokesperson for a while, but then he quit and became an ID advocate. Here’s a link to back this up:
http://www.pitch.com/2005-05-05/news/your-official-program-to-the-scopes-ii-kansas-monkey-trial/
Hitler, of course, was a creationist, at least as far as human beings were concerned.
Hitler explicity rejected Darwinism and the evolution of man.
From Hitler’s Tischgespraeche for 1942 ‘Woher nehmen wir das Recht zu glauben, der Mensch sei nicht von Uranfaengen das gewesen , was er heute ist? Der Blick in die Natur zeigt uns, dass im Bereich der Pflanzen und Tiere Veraenderungen und Weiterbildungen vorkommen. Aber nirgends zeigt sich innherhalb einer Gattung eine Entwicklung von der Weite des Sprungs, den der Mensch gemacht haben muesste, sollte er sich aus einem affenartigen Zustand zu dem, was er ist, fortgebildet haben.’
I shall translate :-
‘From where do we get the right to believe that man was not from the very beginning what he is today.
A glance in Nature shows us , that changes and developments happen in the realm of plants and animals. But nthing shows inside a kind, a development of the size of the leap that Man must have made, if he supposedly has advanced from an ape-like condition to what he is now
And in the entry for 27 February 1942 , Hitler says ‘Das, was der Mensch von dem Tier voraushat, der veilleicht wunderbarste Beweis fuer die Ueberlegenheit des Menschen ist, dass er begriffen hat, dass es eine Schoepferkraft geben muss.’
Hitler also wrote ‘Die zehn Gebote sind Ordnungsgesetze, die absolut lobenswert sind.’
‘The 10 commandments are laws, which are absolutely praiseworthy’
Eh … if you look at the blog, it’s pretty obvious that critical comments are not getting censored. I’d say 75% of them are critical.
Questio – why the comparison between Fox News and Bowling for Columbine? Do you make distinctions between Fox’s editorial shows (O’Reilly, etc.) and their newscasts? Do we admit that all media is spun or slanted to some degree? If this is the case, where is the objective nature of information?
I am as saddened by Ben’s movie participation (however, I would wager he was paid) as I am over Al Gore’s romp Inconvenient Truth. Science has NEVER lent itself well to mass media. One, it is extremely complex and even the safest topics can change rapidly over time.
From time to time I watch Sagan’s COSMOS on DVD> I loved the series, but I note how very dated it has become – not least of which were the hosts cold war / nuclear winter views.
> Questio – why the comparison between Fox News and Bowling for Columbine?
I was making the point that other ‘documentaries’ that I’ve seen were biased. Both of those examples were left-wing, though, so I also wanted to distance myself from any perception that I was doing so out of a right-wing FOX-news watching worldview.
I see Hitler made an “appearance” here – as a creationist.
He’s a man who DEFINITELY should be judged by his works – as he said LOTS of things…which are contradictory…Depends on what audience he had at the moment!
Put “I won’t invade any more countries” against his actual actions. And put his couple of pseudo Christian quotes against his mass massacres of persons who didn’t make his “ideal gene and racial hygiene” list.
But what Hitler TRULY believed is evident in the millions and millions and millions he murdered – many for not being of the “master race”.
PS I think Hitler’s “god” was ultimately himself or some quasi pagan demon driving him on.
i love how PZ Myers speaks of Darwin as if the theory of evolution is a proven fact. By evolution, in the Darwinian sense, I mean the idea that all present life has evolved from a common ancestor through natural selection and random mutations. This is not “the answer” to our past, but only a paradigm that guides and governs modern science, not becuase it has any hard evidence, but becuase it offers a “believable” alternative to special creation. It presents a way to disregard God’s authority over the earth, and becuase man naturally wishes to reject authority, it gives hope to those who follow it. Its amazing the depths that man will reach to try to push God as far from himself as possible. The fact remains that we are created beings put here for the purpose of having a personal relationship with the God who loves us. God must give us a choice wether to accept him or not, becuase if he didnt, then it wouldnt be love for him, but slavery to his demands. God’s word speaks of the types of ideas that Darwin published, and science has pushed when it says, “professing to be wise, they became fools.”
Well, hello David Nelson. Did I mention that I was raised by Christian parents, went to a Christian school, and a Christian college? No, I’m not a Christian now, but I’m quite familiar with that “explanation” of evolutionary theory. The reality is that Copernicus and Newton started the revolution of pushing God farther away when they came up with mechanistic explanations for planetary motion. (We all know angels move the planets!) And, let’s not get started about how germ theory is merely a way for “scientists” to avoid Augustine’s wise suggestion that all diseases are caused by demons (“All diseases of Christians are to be ascribed to these demons; chiefly do they torment fresh-baptized Christians, yea, even the guiltless, newborn infants.”). Clearly, science is just a way to push God further away.
Yeah, I’m very familiar with your “explanation” for evolutionary theory, and I rejected it. So, I’ll offer a counter-explanation: all of the “explanations” of evolutionary theory that say it exists simply to deny God are ways for Christians to dismiss the problematic repercussions of evolution. You might also find a number of Christian scientists (including many of my biology professors at the Christian college I attended) accept evolution – but, I’m sure they only buy into it so they can deny the God that they say they believe in. You might find Ken Miller’s book: Finding Darwin’s God useful. (Yes, he’s a Christian.)
How did life and the universe come to be? An honest scientist must candidly admit that science has not yet been able to answer this question definitively.
A variety of natural theories of origins have been proposed. A scientist’s professional integrity requires that he or she critically examine each theory and point out areas where it falls short of providing a full and adequate explanation of the empirical data.
What evolutionists do not like – what some find intolerable – is that a critical examination of natural explanations inevitably leads people to consider the possibility of supernatural explanations. Evolutionists have decided for themselves (and hold it as one of their most basic core beliefs) that they will not acknowledge even the possibility of an unseen being that possesses the power to design and manufacture the universe and its living beings. They personally refuse to accept the idea of a living God.
It is, of course, their right to make this choice for themselves. The problem enters when they seek to impose their personal choice on others whose minds are still open to all possibilities. Their personal animosity toward the idea of a supernatural explanation of origins causes them to be less than honest in their teaching of science and in their treatment of others who do not share that animosity.
In their teaching they feel compelled to insist that some natural explanation provides a good and satisfactory explanation of origins when in fact every natural explanation that has been offered to date contains serious problems which an honest scientist should probably label fatal flaws. But rather than call attention to those flaws they become willing participants in a conspiracy of silence. They skew their teaching with a view toward hiding the truth.
And if any brave soul has the professional integrity to refuse to be a part of that conspiracy, he or she is professionally crucified, in spite of whatever positive contributions he or she may have made to the advancement of true science.
When the forces of the state and the scientific establishment are arrayed behind one theory in such a way as to squelch all legitimate criticism of it, true scientists must object. When scientists are not allowed to criticize a prevailing theory and propose alternatives, true science does not advance. Science advances when all theories are presented and considered in light of the empirical evidence.
Did Chance design legs for fish or did the Fish realize that they needed legs?
Life is complex not random, for if it was not complex then you could easily toss a mud ball at a wall over and over until it became something like… uh the statue of liberty!
Congratulations. Your analogy is false to begin with. There is a lot of difference between a silicon-water solution spontaneously metamorphosing into a several hundred foot tall -copper- statue, which is what you propose, and a small macromolecule complex, like say a virus, that grows more complex over time until it becomes self organizing, in other words, comes to life, which is what evolution proposes.
One rather simple.
One is kind of stupid.
I’ll let you pick.
Wow, what kind of troll attack did you get here Frog (not you nyronus)? All these weak “arguments” have been debunked for literally over a hundred years. Its truly too bad you guys can’t come up with something new.
Its not that evolutionary theory is a fact, but no other theory has undergone such examination and not only survived but has gotten stronger under the scrutiny, that includes gravity and relativity. so as far as fact goes, its a strong a fact as is gravity, atomic theory, germ theory, and all the other scientific theories that allow you to live as long as you do, as healthy as you do, and as prosperous as you do. Any scientific contraversy about evolution does not lie in whether or not life evolves, but in how it evolves. It is sad that you are not up to speed on this.
In your diatribes, you commit so many logical fallacies its almost funny.
Here, I made you guys a bingo game for your next church meeting.
Maybe you will learn something.
Darwin did not set out to debate God. He believed in god himself so a pronouncement that there is a group of wild eyed atheists pushing their agenda is silly.
I was never taught a thing about evolution in any class nor my parents nor my children. It’s errouious to proclaim that all around the world everyone is being taught evolution and only
that. I was taught about electrons, netrons, errosin of soil,
photosynthises and the metric system because we were going to change to it. Were you taught evolution?
Since I wasn’t taught evolution, would I have to go back and get it?
Remember the Catholic judge who said the ID was religion
based and therefore should not be taught?
Are they going to use science to disprove sciene?
Don’t believe in evoltion? You might consider the transformation of butterflies. Egg to pupa to catepiler to winged creature from a cocoon no less.
We start out as sprem and egg then fetus, then baby, then child, etc. Looks like evolution to me.
You can’t prove or disprove god. He won’t be showing up
as a witness. He swears to tell the whole truth so help him. With science we have a logical set of actions to record and investigate and repeat Science is varifable, measurable, capable of being repeated. God is/does not.
And if we are going to teach creationism, which flavor of god are we supposed to believe in?
Should we forget that Protestants and Catholics were burning each other alive because they didn’t agree on what god wants. Which is the “right” version of religion? Mohamd? Budda? Haly Bop? Amish, Quaker,Hassidic, Shia, Sunni?
Religions were used to justify the Crusades, witch hunting for hundreds of years, enslavement of blacks and natives, gender discrimination, stoning people to death for transgressions real or no.
Look at the middle east where their all killiing each other to the point it’s amazing there’s anyone left alive.
Why do they over look that little, Thou shalt no kill/murder?
comandment? Was it merely a suggestion?
These questions are often what puts us at odds with organized religion. How about Haggard the not gay drug using minister? With stalwarts such as Swaggart, the Bakers, Falwell, is it a wonder the populus has a doubt about our leaders lecturing us on faith?
We use thousands of machines, medicenes, gadgets and gimos knowing humans created it and if my car doesn’t
start its not becuase of Satan possesing it. It runs on sccientific principles, not relgious ones.
Science is all around us, we use it without thought and no one would refute that human engineering made these things possilbe.
So why when it comes to evolution is science wrong?
Mr. Stein can produce what he likes and his opinion is just that. He has free speech to say what he will and not be attacked. We wouldn’t put out a call for his death and offer ransom as some clergy have. However to say his opinion is THE truth, “thems fighting words”.
Religions have been around thousands of years, Darwin’s
theroy only 140 some odd years. Religions carrot and stick on us into believing that we can only be moral if we tow the religious line. It/they are too often used to justify barbarity.
There is also ethnocentric idea that the West has god and no one else does. More justification for killig each other.
I think that evolution is compatible with long time line. Why not take billions of years to get it going?
The world is not divided by our petty squabbles over
who’s right. It is we who make these decisions of “free choice”. One planet one humanity.
If we are to come to God for love of god, then we should be
in agreement with each other, not in the continuous state of battles that we are.
God is written on the heart and soul of every man.
If ID is to be taught, then do so in home school or at church.
The first right is to allow all of us the freedom of thought and speech and freedom from religious tryanny nor being kept from exerscing our rights not to be religious.
Shouldn’t we be looking for ways to interact that are mutually supportive? Or at least allowing for honest unheated discussion? If we are gods kids, then we should treat each other as we would like to be treated ourselves, to coin a phrase.
The problem isn’t that there is no scientific evidence for intelligent design, because there is. Even such a staunch evolutionist as Richard Dawkins has commented on the apparent design in living organisms. Yes, evolutionist claim ID is unscientific. And, by their definition it is, because they exclude any explanation that is not naturalistic. Since the beginning was a one time event that cannot be duplicated, both ID and evolution rests on uproven hypothesis.
Evolution has many difficulties, not the least of which is the spontaneous generation of life. It is still a valid law of science, that only “life begets life”. Because Carl Sagan recognized that dead matter springing to life here (on earth) was statstically impossible, he suggested that it was imported to earth by aliens. Contrary to the extravagant claims of evolutionist, there is absolutely no proof, and precious little that could even be called evidence, that dinosaurs turned into birds or that man descended from apes.
Are many ID proponents Biblical creationist? Yes, but that does not alter the evidence for design that is so apparent. The fact that we may have been designed still does not tell us who the designer was. That is a philosphical question, not a scientific one.
If the case for ID is as weak, and their position as strong, as evolutionist would have us believe, then they really have nothing to worry about if the scientific arguments are placed side by side. Truth has nothing to fear from open discourse, the same cannot be said for falsehood.
DCave,
Many of the claims you have made are completely false. While it is impossible for life to “spontaneously” come from non-living matter, it has been scientifically shown that the acids and proteins necessary to create RNA can form together rather easily (and are apt to do so) in a certain type to mud that has been shown to have been in abundance in the Earth’s early life. This RNA could then join with other RNA strands to form DNA, which, as anyone who took high school biology can tell you, attracts lipids (also prevalent in the same mud type substance). So we now have DNA encased in a “shell” of lipids which, call me crazy, sounds like a simple cell.
It has also been shown that simple cells can become more and more complex, to the point at which you and I would recognize them as “living.” So by combining these two pieces of research it becomes clear that life on Earth could have come about simply because of the mechanics of molecular behavior, which are readily observable in laboratory conditions.
Now that I’ve shown the evidence for evolution let me try my best to tackle your theory on creationism (not intelligent design, because that is a term invented and used to hide the religious link within the theory) being taught in schools along side evolution. You state that:
” If the case for ID is as weak, and their position as strong, as evolutionist would have us believe, then they really have nothing to worry about if the scientific arguments are placed side by side. Truth has nothing to fear from open discourse, the same cannot be said for falsehood.”
But this isn’t true. Teaching weak, unsupported theories next to strong theories puts them on the same platform and makes students think the two are equal, so students won’t look at the two and weigh the evidence but instead see that they are both being taught and so both must have real evidence for them. By your logic we should teach the theory of demonic possession and faith healing next to germ theory. Just because the scientific explanation goes against the popular religious belief doesn’t mean the scientific community has to be apologetic and present a fairy tale as an alternative.
I ask that you please do actual research into a subject before you pretend to be an expert on the situation. You obviously haven’t studied evolution or educational psycology/sociology (which prove your points invalid).
Dustin R,
I never claimed to an expert, but I have read enough from evolutionist to know they are long on theory and short on facts. You said many of my claims were false. Name one, and offer the proof, not opinion. Even some evolutionist have talked about evolutions “just so stories” that are unsupported by the evidence.
As far as your claim that the acids and proteins necessary for life easily forming on earth. That is at best a misleading statement. Because in order for life to arise, proteins must contain only one chiral form of amino acids, left or right. Of course evolutionist have an answer for that problem. The left handed amino acids necessary came from space on meteorites. You don’t believe me. Do your research. If that flies for you, fine. But we still have that problem of spontaneous generation of life.
As far as simple cells becoming more and more complex until we would call them “living”. Are they living, or are we just calling them living? Some cells can combine, but there is still no new information provided. By the way, many scientist say there is no such thing as a simple cell. Even the “simplest” living organisms carry an enormous amount of information.
You have not shown the evidence for evolution. All you have done is made some misleading statements and a few unproven allegations.
You did make a couple of statements I agree with. The one about the impossibility of life springing from non-living matter. I couldn’t agree more. You also said, “You obviously haven’t studied evolution or educational psycology/sociology (which prove your points invalid).” I agree, I haven’t studied evolution, because you can’t study what never happened, although I have studied the theory enough to know it is mostly smoke and mirrors. I also have not studied psycology/sociology. How that invalidates anything I say escapes me. A statement is either true or false regardless of says it or what they have studied.
I do give our school students a little more credit for intelligence than you do. If the arguments are laid out side by side, I believe they are capable of coming to their own conclusions.
DCave,
I did not say anything that hasn’t been proven in a laboratory setting. It is scientifically proven that DNA replicates, and that DNA could form in conditions that were abundant on early Earth. With replication we get random mutations which leads to adaptation and evolution. I’m sorry I didn’t realize I had to spell out ever facet of the DNA process. Especially since you have said that you’ve studied this. And yes while cells do contain a lot of information even the “simple” cells we have today must have come from these original DNA/lipid “simple cell.” When I said simple cell I meant something with a very simple structure with a protective shell surrounding a construction in which DNA replication occurred. Arguing that this isn’t clear evidence that it is not only possible but likely for simple cells to have evolved on early Earth without the need for a magical man in the sky is to deny the simple facts laid out before you–which seems to be the only way creationists can make arguments against evolution.
As for you giving credit to students, the facts also disagree with you on that one too. That’s why I brought up psychology/sociology. Studies in those fields have shown that children (especially younger children) are most moved by their teachers and educators. Most children never question the totality of what they are taught unless they have an even strong influence (like their parents or social group) telling them something different (and most children do not, unless of course they have “churchy” parents who tell them that evolution isn’t true). So by teaching both creationism and evolution kids will think both have scientific evidence to support them and both are somehow valid. This simply isn’t true. Creationism is obviously religiously based and thus should be kept out of school. Allowing such blatantly religious propaganda into schools the next thing you know people will be demanding prayer in school and generally ignoring the constitution right of freedom of religion.
Honestly creationism is nothing more than saying “I don’t understand how this happened so it must be magic.” As is any religious belief. Belief in any god is saying that you don’t want to critically think about problems you just want to read a book of ready made answers whether or not those answers are true. And when those answers are proven wrong by science you get upset and say the science must be wrong. This happened when it was found that the Earth isn’t the center of the universe. Actually the pope at that time was quoted as saying “Saying the Earth is not the center of the universe is the same as saying Jesus was not born of a virgin.” Obviously now everyone knows the Earth is not even the center of our solar system, let alone the universe. And now the church agrees with science, meaning the church can’t fight facts with faith, because faith in opposition to facts makes one look foolish. This argument will go the same way as the argument of cosmology, the church will finally be bombarded with more and more facts while they continue to use the same tired and unfounded arguments and will be forced to fold and change their beliefs. It’s sad that you religious types never learn from the past and see that religion has never won against science, and why? Because science is made of facts and observations while religion is based on fairy tales and falsehoods.
Dustin R,
You are grossly overstating what scientist know as opposed to what they theorize. At this point scientist are undecided on whether the earth had an oxidizing or a reducing atmosphere. Current theory requires a reducing atmosphere. If the possibility for life to have begun spontaneously on earth were as likely as you would have us believe you would not have scientist like Carl Sagan and Francis Crick (co-discover of DNA) suggesting it was brought here by aliens from outer space. While this is a minority view (like ID) it is still being advanced by some. The current popular view (at least of Apr 6, 2008) is that the left handed amino acids that constitute practically all life forms are the result of meteors peppering the earth. So you see, scientist not only don’t agree on how it happened, they can’t agree on where it happened. So why should I take their word that it did just happen. As far as mutations and selection resulting in anything other than so called micro-evolution, i.e. adaptation within kind, the biological evidence is against it. Mutations and natural selection result in a loss of information, not an infusion of new information necessary to transform one kind of animal into another.
Scientist have known for a long time the basic building blocks of life and have been trying to create life in the laboratory for a long time without success. Although fairly recent articles suggest they are getting close. They don’t explain exactly how you know you are getting close to bringing dead matter to life, but at least that is their claim. While scientist can create the necessary amino acids in the lab and I understand may have synthesized some of the proteins, they are still completely at a loss to explain where the information in DNA and transcribed by RNA came from. By the way, this is using intelligence to try and prove something happened by random chance. Actually, the only thing it would prove is you could do it through intelligence. But I am not worried about them succeding.
I notice you brought religion into the discussion. Funny how it is the evolutionist who keep bringing up religion. If the science was on their side that wouldn’t be necessary. By the way, the Pope does not and never has spoken for me in matters of either religion or science.
I never suggested indoctrinating young, impressionable children with ID, although it seems perfectly alright to brainwash them into believing evolution has been proven when it most certainly has not.
You say I have made false statements, but you still haven’t pointed any of them out. I will leave you with this quote from an evolutionist:
“We take the side of science in spite of the patent absurdity of some of its constructs, in spite of its failure to fulfill many of its extravagant promises of health and life, in spite of tolerance of the scientific community for unsubstantiated just-so-stories, because we have a prior commitment, a commitment to materialism. It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door.”
Richard Lewontin, Billions and billions of demons, The New York Review, p. 31, 9 January 1997
P.S. This is the kind of attitude that led to Ben Stein making his movie.
DCave,
I’m not the one who brought religion into this, you did. You may say “I never mentioned religion” but the entire creationist argument revolves around proving that some kind of deity created us, which is a religious belief. The simple fact that creationism (please note once again it’s creationism not intelligent design, because ID is just a term used to make a blatantly religious belief sound scientific) is a religiously based system of looking at our origins and as such serves no place in the science classroom. End of discussion.
Also I recently read an article which made a beautiful metaphor for the evolution v. creationism debate. It went something like, creationists want to say evolution is untrue because of the holes in the theory, but that’s like saying a fishing net doesn’t exist because it has holes in it but just tell the fish caught in it that it isn’t there. Science has always worked in this manner, sure there are unanswered questions but thats just how the process goes. Evolution fits with all the known evidence, and over time the holes get filled in as our technology and understanding get better. Creationism will never fill in the biggest hole of all, which is prove the existence of some kind of creator. You can’t bitch about a lack of proof in evolutionary theory when your own theory is by it’s own definition unprovable.
PS : You are fucking retarded.
Dustin R,
Its just as I thought. You cannot prove one thing I said is false. So you resort to insults. That is a common tactic of evolutionist. It isn’t just that there are holes in the theory, the evidence runs counter to its claims. Evolutionist have been trying for 130 years to fill the holes, with no success. Evolution does not fit with all the known evidence. The spontaneous generation of life has never been observed. No one has ever seen one kind of animal turn into another, mutations and natural selection do not add information they subtract information, the fossil record does not show a gradual progression from least complex to most complex, there is not one “known scientific fact” whereby you can logically deduce that evolution actually happened. And I challenge anyone to prove otherwise. Don’t bring up finches beaks or or other examples of micro-evolution. That is adaptation within kind, and never adds new information, and can result in a complete loss of some information.
I know I am wasting my time on you because you have already declared an end to the discussion. But just maybe a few people will look seriously at both sides of the issue. If you take off the blinders, you will see that the case for evolution is exceedingly week. You may still believe in it, but if you do it will be in spite of the evidence and not because of it.
You also stated, and I quote, “You can’t bitch about a lack of proof in evolutionary theory when your own theory is by it’s own definition unprovable.” So apparently, you agree there is a lack of proof. Which is my point all along. Quit teaching it as fact and present the whole picture, holes (pun intended) and all, and then let the public decide.
As far my theory being unprovable, if you mean proving there is a God scientifically, I agree. But you can still look at the evidence an infer that, boy, this sure looks like it was designed. Who the designer was is a philosophical question, not a scientific one. Occasionally when poking around an old homestead, I have found artifacts consisting of several moving parts, but I could not figure out what they were, or who made them. Even though I did not know where they came from or who made them, not once did I see, gee I don’t who made this, so it must have just happened. Yet, that is what people believe in regard to all the complexities of the universe. Truly, no intelligence is allowed.
At this point scientist are undecided on whether the earth had an oxidizing or a reducing atmosphere. Current theory requires a reducing atmosphere.
I talk about that in another post you can find here:
http://tinyfrog.wordpress.com/2008/01/19/the-non-believers-review-of-%e2%80%9cthe-case-for-faith%e2%80%9d-objection-3-part-2/
As far as mutations and selection resulting in anything other than so called micro-evolution, i.e. adaptation within kind, the biological evidence is against it. Mutations and natural selection result in a loss of information, not an infusion of new information necessary to transform one kind of animal into another.
Untrue. Mutations create lots of changes. Most of those changes will be neutral or negative. Natural selection filters those mutations – bad mutations are eliminated from the gene pool, and good mutations get spread throughout the gene pool. Let me put it to you this way: Let’s say you had a gene sequence like this:
ACGAGCGAGUCGACAUGCCAACGACGUAGC
Now, let’s say that one particular mutation would make that gene sequence work slightly better. However, to do that, you need to change the 10th nucleotide from “U” to “A”. Let’s say that all other changes immediately kill the creature. Well, if one point-mutation happens, there’s a 1 in 90 chance of turning the 10th nucleotide from “U” to “A”, but a 89 in 90 chance of killing the creature. Pretty bad odds, huh? It’s like a very bad version of Russian Roulette. But, what if you have thousands of creatures. What happens if you occasionally cause a point-mutations in those animals over a span of many generations? Well, most of the time, you end up killing individual animals. However, 1 in 90 get a beneficial mutation that turns the 10th nucleotide from “U” into “A”. That animal survives a little better than the rest, and that particular gene sequence (with the mutation) spreads through the gene pool and now you have an entire species that has the new, beneficial mutation. The upshot is this: beneficial mutations, even when they are much more rare than bad mutations, can proliferate and spread through the entire species making the whole species stronger. It comes down to mathematics and probability.
It isn’t just that there are holes in the theory, the evidence runs counter to its claims. Evolutionist have been trying for 130 years to fill the holes, with no success. Evolution does not fit with all the known evidence. The spontaneous generation of life has never been observed. No one has ever seen one kind of animal turn into another, mutations and natural selection do not add information they subtract information, the fossil record does not show a gradual progression from least complex to most complex, there is not one “known scientific fact” whereby you can logically deduce that evolution actually happened. And I challenge anyone to prove otherwise. Don’t bring up finches beaks or or other examples of micro-evolution. That is adaptation within kind, and never adds new information, and can result in a complete loss of some information.
Sorry, DCave, you’ve completely wrong on these points. I’m sorry you’ve been mislead on these ideas by creationists.
“The spontaneous generation of life has never been observed.”
I’ll leave it to my earlier link to cover this topic. Although, it’s not strictly necessary to believe in the spontaneous generation of life to believe that evolution happens and happened historically.
“No one has ever seen one kind of animal turn into another”
The problem is that any mutation is going to have a small effect on an animal. In the majority of cases, a beneficial mutation begins in a single individual and spreads to the entire gene pool. The result of this is that you never see large evolutionary “leaps” happening. It’s also a conceptual problem: we mentally put organisms into groups. And, if there is a small change, we simply say, “well, it’s just a (blank) plus a little extra – but it’s still a (blank)”. The problem is that people resist expanding the conceptual groups, and that leads to the misconception that the groups are immutable.
“mutations and natural selection do not add information they subtract information”
Untrue for the reasons I listed above. I can produce a better example, if you prefer.
“the fossil record does not show a gradual progression from least complex to most complex”
But it does. For billions of years, life was restricted to single-celled organisms. Multicellular early life was very primitive – jawless fish, for example. And then it took almost 200 million years before there were any land animals (with their complex weight-bearing limbs). Animal’s brains were small for a very long time (no doubt, you’ve heard of how small dinosaurs brains were).
“there is not one “known scientific fact” whereby you can logically deduce that evolution actually happened”
Why, there are plenty. Mathematics underpins the fact that evolution should happen via random mutation and natural selection. Genetics allows us to trace the mutations that occurred in the past, and determine how quickly these mutations accumulated in the gene pool. Groups of species contain the same genetic errors – inherited from a common ancestor. For example, humans, chimps, and gorillas share an identical genetic defect. Cats (ranging from housecats to lions) contain another genetic defect in common. You can read about these genetic errors here:
http://tinyfrog.wordpress.com/creationismevolution/
“That is adaptation within kind, and never adds new information, and can result in a complete loss of some information.”
I’m fully prepared to show you this statement is untrue.
I will leave you with this quote from an evolutionist:
“We take the side of science in spite of the patent absurdity of some of its constructs, in spite of its failure to fulfill many of its extravagant promises of health and life, in spite of tolerance of the scientific community for unsubstantiated just-so-stories, because we have a prior commitment, a commitment to materialism. It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door.”
Richard Lewontin, Billions and billions of demons, The New York Review, p. 31, 9 January 1997
While I have no particular reason for dismissing the possibility of God outright, I’m afraid this quote isn’t actually about evolution, but about science in general and the fact that divine explanations can derail science — in all it’s forms. Personally, I don’t particularly agree with the quote, but I’ve quoted it in its original context below. Note, that he’s talking about science in all it’s forms, and when he says “in spite of the patent absurdity of some of its constructs”, he’s talking about stuff that’s very well established (like the particle-wave duality of light), so he’s saying that some science *appears* absurd, but isn’t really absurd – merely counter-intuitive. I do agree with this quote in as much as it argues that we should not rush to replace counter-intuitive (but correct) science with divine explanations. (Your original quote is in bold.)
“With great perception, Sagan sees that there is an impediment to the popular credibility of scientific claims about the world, an impediment that is almost invisible to most scientists. Many of the most fundamental claims of science are against common sense and seem absurd on their face. Do physicists really expect me to accept without serious qualms that the pungent cheese that I had for lunch is really made up of tiny, tasteless, odorless, colorless packets of energy with nothing but empty space between them? Astronomers tell us without apparent embarrassment that they can see stellar events that occurred millions of years ago, whereas we all know that we see things as they happen. When, at the time of the moon landing, a woman in rural Texas was interviewed about the event, she very sensibly refused to believe that the television pictures she had seen had come all the way from the moon, on the grounds that with her antenna she couldn’t even get Dallas. What seems absurd depends on one’s prejudice. Carl Sagan accepts, as I do, the duality of light, which is at the same time wave and particle, but he thinks that the consubstantiality of Father, Son, and Holy Ghost puts the mystery of the Holy Trinity “in deep trouble.” Two’s company, but three’s a crowd.
Our willingness to accept scientific claims that are against common sense is the key to an understanding of the real struggle between science and the supernatural. We take the side of science in spite of the patent absurdity of some of its constructs, in spite of its failure to fulfill many of its extravagant promises of health and life, in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism. It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is absolute, for we cannot allow a Divine Foot in the door. The eminent Kant scholar Lewis Beck used to say that anyone who could believe in God could believe in anything. To appeal to an omnipotent deity is to allow that at any moment the regularities of nature may be ruptured, that miracles may happen.”
tinyfrog,
The quote in its context doesn’t change a thing. Scientist are dedicated to materialism, and therefore they are not willing to even consider anything that might upset that world view. Even if the evidence not only doesn’t support that view, but is counter to it. That is exactly what the quote says.
tinyfrog
I did not say mutations or natural selection never resulted in any changes. I said they don’t add new information. And you cannot prove otherwise. Most mutations are either harmful or neutral, and even the occasional beneficial mutation results in a loss of information. You said, “What happens if you occasionally cause a point-mutations in those animals over a span of many generations?” Who do you mean is causing it? I thought this was all blind luck. Quoting you again, “The upshot is this: beneficial mutations, even when they are much more rare than bad mutations, can proliferate and spread through the entire species making the whole species stronger. It comes down to mathematics and probability.” I believe natural selection plays a much bigger role in providing changes in a species over time than mutations. I even believe they can result in what biologist would call new species. But we aren’t talking about strengthening a species, we are talking about changing one kind of animal into a different kind of animal. There is still no evidence that mutations provide the new information needed to change a bat into a bird. I know, birds came from reptiles, so the evolutionist say, but you get the idea.
As far as spontaneous generation not being necessary for evolution; as I understand it, Darwin himself never considered that aspect of it. But it is a fact that life is here, and it had to come from somewhere. Whether that was on earth, some other planet, or some other galaxy. Either it spontaneously arose, it was created, or it always existed. Now as far as I know, no credible evolutionist claims it is eternal, so that leaves created or spontaneous generation. So spontaneous generation is very much a part of evolution theory. I don’t have the time to go back and find the quotes again, but even prominent evolutionist have said as much. So quit trying to blow smoke.
Quoting you again: “Mathematics underpins the fact that evolution should happen via random mutation and natural selection. Genetics allows us to trace the mutations that occurred in the past, and determine how quickly these mutations accumulated in the gene pool.” The only problem is, the evidence does not support that evolution has even happened, much less that it came about through random mutations and natural selection. Artificial selection (breeding) has shown that there are limits to how much you can change morphology. Those limits do not include creating new kinds of animals. The conclusions drawn by geneticist are based on assumptions that cannot be proven by observation, so they can be used to infer something, but not to prove anything. Scientist are free to infer anything they want, but they should quit saying evolution is a proven fact, when that is not the case. Since you brought mathematics into the equation, maybe you should go back and see what the mathematics (of evolutionist) has to say about the possibility of spontaneous generation. It is so far outside the laws of probability that men like Francis Crick believe life must have been imported by space aliens. But, where did they come from? Of course you probably find such hypothesis as Crick’s and others just far fetched enough to be believable. In fact, nothing is to far fetched for evolutionist to believe as long as there is no intelligence involved.
DCave,
First off, you have the most flawed and blatantly incorrect idea of genetics, history, and evolutionary theory I’ve ever seen. It’s as if you watched the Ray Comfort/Kirk Cameron show that’s on the jesus-freak networks, saw the one about evolution and just assumed everything they said was true without researching it at all and then spewed that onto this web page…tinyfrog already pointed out pretty much all of your errors there so I’m not going to repeat him, but you should reread his posts until you understand them.
As for me insulting you, it had nothing to do with me not being able to argue against your points, it’s just that your points are so invalid it literally makes me angry. I’m a philosophy major so seeing unfounded invalid arguments upsets me. Let me tell you why creationism isn’t scientific one more time. Science is about things that are observable or at least can be extrapolated from observable evidence. Creationism cannot be observed as a creator cannot be observed or extrapolated from observable evidence. Even you argument of complex things must have had a creator is a philosophical argument not a scientific one. The only reason creationist want this idea taught in science classrooms is because they feel that evolution somehow disproves or makes kids doubt the existence of whatever god they might worship (let’s face it almost all creationists are judeo-christian so that god in particular). It isn’t sciences problem if the best scientific theory causes a crisis of faith, that just means there is a good reason not to believe in whatever you believe in. Science doesn’t make assumptions like “wow this looks complex and hard to figure out so something must have made it” science looks at something and says “hmm I wonder where this came from.” It then looks at the evidence to see where it came from. If the evidence points to someone making it (say someone coming up and saying ‘hey I made that’ or finding finger prints on it) then it will conclude that, but if the evidence says that it gradually came to be through a complex series of actions not lead by anyone then that will be the reached conclusion (say something like bismuth that is a very complex geometric mineral that forms naturally without need of any creator yet is complex in it’s own right). If you want to argue the complex angle it belongs in a philosophy classroom not in one of science, because it is an unscientific assumption. It is a philosophical question (and one that has actually been debated for centuries).
Also I would like to point out something. Most creationists say evolutionary theorists don’t like creationism because it goes against the established idea. This isn’t true. Say someone discovered a new theory into our origins and it was completely different from evolution. Let’s say this theory had more evidence than evolution and was overall much stronger. The scientific community would be hesitant at first but after it claims were substantiated that theory would become the established idea. We don’t go against creationism because it goes against the established idea but because it has a weaker argument (much weaker) than evolution. It’s regressive. To quote a friend of mine:
“Think of it this way. A bunch of astronomers are at a conference talking about dark matter and other complex astronomical/physical phenomenon, and there’s a group of dicks in the corner constantly screaming “WHY DO WE NO LONGER ENTERTAIN THE IDEA THAT THE EARTH IS FLAT??”
Is it prejudicial/discriminatory to not listen to them or even to eject them from the conference? No. We don’t need to entertain their ideas any more. To do so is regressive.
This is why we are intolerant of Intelligent Design. It’s not some atheist conspiracy. It’s progress.
Deal with it.”
Dustin R,
I have asked you to name one thing I said that was false, and so far you have just ranted and raved. Now you have brought out the old flat earth canard. There are no scientist that I know of still claiming the earth is flat, but if you can’t win the argument, you can always engage in ridicule. By the way, I had never heard of either Ray Comfort or Kirk Cameron until you mentioned them.
I have no objection to anyone believing evolution, but I do object to it being presented as fact, when the evidence for it is exceedingly weak. There is a reason why, even after years of it being taught as fact in our public schools (to impressionable youngsters by authority figures), that many scientist question it. And it isn’t because they are all a bunch of religious quacks. Not all of them even profess to be religious. If you and others want to close your minds to any other possibility that is OK by me, but Tinyfrog has not disproved one thing I said. So, evolution theory has made a few predictions that came true. It has also made some that didn’t come true. Evolution predicts a progression of life forms from simple to complex, but the fossil record does not support that prediction. Evolution predicts that there should be multiplied thousands of transitional forms (even Darwin said that), to date there is not one that can definitely be identified as transitional, and precious few that any case could be made for whatsoever. You can’t even find one that all evolutionist agree on. Evolution predicts that the more two classes of animals resemble each other the more genes they share, but often that is not true. These just came off the top of my head, but there are more. So if we are going to base the validity of evolution on how well it predicts, it is a false theory. At best, if a theory makes some good predictions and some bad predictions, then it is still in question.
You said, and I copied your quote so any typos (I know I have a few) are in the original; “Even you argument of complex things must have had a creator is a philosophical argument not a scientific one.” I’m not sure I ever said complex things must have a creator, but I do believe it is a reasonable assumption. One thing is for sure, science has not proven or observed that complexity can arise from random processes. In fact, it is only when we get to evolution, that we don’t assign a designer to complex structures. Yet, biological systems are the most complex items known to science. Now, as a scientist, you need not accept the idea that something as complex as the human body requires a designer, but it is the height of arrogance to say that your view is the only possible view when it is founded on the flimsiest of evidence, and an unproven hypothesis, i.e. life sprang from dead matter.
DCave,
I’m going to go in reverse order here for a second and answer you last statement. Let me reiterate that creationism is a philosophical query and not one of science. Everything you said agrees with that. If you were to take PHIL 101 you would understand that. Saying that object X or process Y is so complex it could only have been created by some kind of intelligence (ie god) is philosophical in nature because it presupposes a claim without first examining all natural solutions. Even the way you posited your claim was in the manor of the normal philosophical argument.
1. Biological processes are complex
2. Complex things can only come from more complex things
—–
3. Therefore something more complex must have created biological organisms.
You make a claim based on assumed premises. This argument is valid (note: in philosophy valid means that IF the premises are true the conclusion must be true as well). The soundness of this argument is very questionable (note: soundness is philosophy means that the premises are true and the argument is valid. So an argument can be valid and yet its conclusion can be false if it is unsound). Your second premise is very suspect but if you could gather enough information and prove it to be true then you could make a case for the soundness of your argument (although no philosophical arguments for or against any god has every been able to be proven or disproven, as far as soundness is concerned). But no matter the soundness of this argument it isn’t a scientific one. The second premise makes an assumption that cannot be empirically proven or even extrapolated from previous data, thus science disagrees with creationism because it is outside the field of science, and thus it should not be brought in.
Also let me reiterate that if someone came up with a new theory on our origins that was stronger than evolution and was scientific in nature it would be accepted as the mainstream idea. As long as it is a scientific idea it will not be shunned, creationism simply isn’t scientific.
And as far as your statement of evolution being taught as “fact” let me simply say that the theory of gravity is taught as fact, yet it is only a theory, as is the theory of relativity, and all the universal laws of science. These are all theories but they are accepted to be truth because there is no reason not to take them as such at this time. If someone could disprove Newton’s laws or something and could posit a better theory to better explain the universe around us in a scientific matter that man would be a genius. But as it stands right now the scientific theories are the best ways to describe our universe and so we hold them as facts.
Now for your little cute idea that the fossil record doesn’t agree with evolution. Are you going to tell me that a trilobite is more complex than say a dog? Or that a jellyfish is more complex than we are? That is ludicrous, the oldest fossils in the fossil record are very simple and now organisms are very complex. There are periods when the process takes a step backwards but this can be attributed to global mass extinctions which can be caused by any number of catastrophes (say a meteor hit the earth can caused an ice age or a gamma ray burst from a near-by star raising the temperature dramatically in a short amount of time killing off a majority of life on Earth). When these kinds of disasters occur it is almost a game of chance as to which species survive and which can’t handle the new environment, and so a simple organism living deep underwater would survive a gamma ray burst (at least a weak one) much better than creatures on the surface. So the whole process takes a step back as the more complex organisms living in vulnerable areas die off from a catastrophe and over time the remaining organisms continue to evolve and we reach the same level of complexity and sometimes surpass it. For someone who claims to have studied this you really don’t know much about it.
The quote in its context doesn’t change a thing. Scientist are dedicated to materialism, and therefore they are not willing to even consider anything that might upset that world view. Even if the evidence not only doesn’t support that view, but is counter to it. That is exactly what the quote says.
I think there are several problems with that statement. First, there are Christians who not only subscribe to evolution based on the evidence, but argue that evolution happened. Second, you are making the assumption that all evolutionists subscribe to the argument that Richard Lewontin makes. I could easily quote some creationist who rejects evolution on a purely theological basis. (In fact, I’ve heard the words “That’s not what the Bible says” as a rebuttal to evolution in the past.) Is is right for me to claim that all creationists are concerned purely about theology, and immune to the facts? Apparently so. I suspect you would’ve detected this fallacy yourself if it didn’t play into your particular biases about scientists. Third, the context does change things. He’s obviously talking about things like wave-particle duality, which are true but un-intuitive. When he uses the word “absurd” he is speaking not about things that are absurd, but things that merely seem absurd at first glance. If we take his argument as you read it, then we should actually reject lots of modern science. Fourth, you complain that this is some kind of admission that evolution is absurd (it’s not), and that his philosophical belief (keep God out of explanations) is the problem. Lewontin thinks life and planetary-orbits should have naturalistic explanations. Okay. You’ll complain about this philosophy when it comes to evolution, but not when it comes to planetary-orbits. Why? Because you believe evolution is bad science, and explaining planetary orbits with gravity is good science. The problem is that I see “evolution explains life” and “gravity explains planetary orbits” as good science in both cases.
I did not say mutations or natural selection never resulted in any changes. I said they don’t add new information. And you cannot prove otherwise. Most mutations are either harmful or neutral, and even the occasional beneficial mutation results in a loss of information.
Well, then you should provide me with a description of the word “information”. Typically, creationists like to point to Shannon Information to claim that “information” exists as a quantifiable value. However, it’s obvious that creationists aren’t using Shannon Information when they talk about “Information”. Instead, most creationists use “Information” synonymously with “useful”. A random sequence of nucleotides contains Shannon Information, but (usually) contains no useful information. Now, you’re saying that beneficial mutations (i.e. useful sequences) aren’t information. So, I’m at a loss. What definition of “information” are you using? If you can’t define what you’re talking about, then you can’t complain that I can’t prove evolution creates it.
You said, “What happens if you occasionally cause a point-mutations in those animals over a span of many generations?” Who do you mean is causing it? I thought this was all blind luck.
It is. Random mutations occur. Random mutations will (according to probability), hit on beneficial changes.
But we aren’t talking about strengthening a species, we are talking about changing one kind of animal into a different kind of animal. There is still no evidence that mutations provide the new information needed to change a bat into a bird.
When compare species at a genetic level, you discover lots of small changes all over the genome. This is exactly the type of changes you’d expect from a mechanism of random mutation + natural selection. Sure, you can say that you don’t believe mutations can do that – when you stand back and look at the physical structure of creature A and creature B, but when you get down and look at the genetics, you have to shake you head and say – yes, this is very possible. I’m sure you’d be amazed at the incredible similarity of chimpanzee and human DNA.
So spontaneous generation is very much a part of evolution theory.
Spontaneous generation is very much a part of naturalism and an atheistic worldview. On the other hand, it’s entirely possible for theists to believe God started things and naturalistic evolution to take care of things from there. If you want to argue against evolution, then you should argue against evolution. Instead, you’re pointing at spontaneous generation and then claiming evolution must be false. You’re claiming that “God started life” therefore “evolution can’t happen”, which is a non-sequitur.
I don’t have the time to go back and find the quotes again, but even prominent evolutionist have said as much. So quit trying to blow smoke.
It doesn’t must matter to me what “prominent evolutionists” have said. And, I won’t hold you to defending what every “prominent theologian” says.
The only problem is, the evidence does not support that evolution has even happened, much less that it came about through random mutations and natural selection.
I’m unclear on why you are repeating this. Have you read about the genetic evidence for evolution? Did you read the posts I linked to about the common genetic errors in groups of species – the vitamin C genetic defect found in gorillas, chimpanzees, and humans – the sugar-tasting defect found in dozens of cat species? Can you come up with any plausible explanation that explains these patterns without referencing common descent?
http://tinyfrog.wordpress.com/creationismevolution/
much less that it came about through random mutations and natural selection.
When you get down and look at the genetic differences between species, you quickly realize that these are the types of changes that you would expect to be produced by random mutation and filtered through natural selection.
Artificial selection (breeding) has shown that there are limits to how much you can change morphology.
Yes, artificial selection alone has limits because you’re working with an existing set of genetic variations. That’s where random mutation comes in – it adds to the gene pool. Accumulate enough mutations and morphology can be changed dramatically.
The conclusions drawn by geneticist are based on assumptions that cannot be proven by observation, so they can be used to infer something, but not to prove anything.
You need to look at genetic differences between species – they’re not as great as you seem to think. Once you do, you’d realize that evolution could have happened, and there are patterns left by the evolutionary process. As for “proving” it – well, I consider these to be wiggle words. Science isn’t in the business of “proving” anything – that’s just a popular misconception. Has science proved that antibiotics work against bacteria? Nope. Maybe God intervenes against bacteria whenever you take an antibiotic. Maybe invisible aliens are intervening to heal people who take antibiotics. So long as a million other possibilities exist, then we can’t prove antibiotics do anything. Similarly, we can’t “prove” evolution happened – as opposed to a deity planting fossils in the ground and making our genetics look evolved. Of course, you can quickly fall into Last Thursdayism with that kind of talk.
It is so far outside the laws of probability that men like Francis Crick believe life must have been imported by space aliens.
Despite your claim that abiogenesis is “so far outside the laws of probability…”, Crick has said that he was overly pessimistic about the possibility of abiogenesis because we had not anticipated modern RNA-world ideas. To quote him in a 1993 paper:
“Tinyfrog has not disproved one thing I said.”
I’m not clear on what you’re talking about. You’ve retreated to not even disputing most of what I said. You don’t seem to have read the article I linked to. In most cases, you simply restated your claims while pretending that I never disputed them.
“So, evolution theory has made a few predictions that came true. It has also made some that didn’t come true.”
Out of curiosity, I’d like to know what exactly you think evolution has predicted correctly, because, based on your writing, I would’ve guessed you think it has predicted nothing correctly.
“Evolution predicts a progression of life forms from simple to complex, but the fossil record does not support that prediction.”
Oh, but it does. I’m unclear on why you ignore what I wrote without attempting to dispute it, and simply repeat yourself.
“Evolution predicts that there should be multiplied thousands of transitional forms (even Darwin said that), to date there is not one that can definitely be identified as transitional, and precious few that any case could be made for whatsoever.”
Did you read the section on whale evolution that I linked to? Here’s a run-down of transitionals to take a look at:
http://pandasthumb.org/archives/2008/03/transitional-fo.html
http://www.nature.com/nature/videoarchive/ancientwhale/index.html
http://sfmatheson.blogspot.com/2007/10/they-selected-teosinteand-got-corn.html
http://scienceblogs.com/pharyngula/2007/03/yanoconodon_a_transitional_fos.php
http://scienceblogs.com/pharyngula/2007/03/coelacanth_evolution.php
http://scienceblogs.com/pharyngula/2006/10/gogonasus_andrewsae.php
http://scienceblogs.com/pharyngula/2006/05/no_genes_were_lost_in_the_maki.php
http://scienceblogs.com/pharyngula/2006/04/how_to_make_a_bat.php
http://scienceblogs.com/pharyngula/2006/04/najash_rionegrina_a_snake_with.php
http://www.corante.com/loom/archives/2005/09/22/the_steps_of_the_puzzle.php
“You can’t even find one that all evolutionist agree on.”
I think you’re just making stuff up now.
“Evolution predicts that the more two classes of animals resemble each other the more genes they share, but often that is not true.”
No, evolution doesn’t predict that *at all*. Evolution would *not* predict that the marsupial mouse and placental mouse would have a lot of genes in common (relative to other mammals). Evolution predicts that their common ancestors diverged a *very* long time ago (100 million years+), and therefore should have very little in common compared to how similar they are to other species of the same group. For example, evolution predicts that an elephant (placental) and a placental mouse should have more in common than a placental mouse and a marsupial mouse. Evolution predicts that a whale (placental) and an placental mouse will have more in common than a placental mouse and marsupial mouse. It also predicts that a kangaroo and marsupial mouse will have more in common than a marsupial mouse and a placental mouse. I think part of the problem here is that you don’t quite understand evolution well enough. This puts you in a weird position of disputing it while making assumptions about what evolution predicts, and those assumptions serve to reinforce your existing beliefs.
“So if we are going to base the validity of evolution on how well it predicts, it is a false theory.”
I think you need to understand evolution well enough to understand what it predicts first.
“In fact, it is only when we get to evolution, that we don’t assign a designer to complex structures. Yet, biological systems are the most complex items known to science.”
You are laboring under the assumption that evolution is incapable or less capable of producing complex systems. It is not.
“it is the height of arrogance to say that your view is the only possible view”
No, it’s supported well by the evidence. If you argued that angels guide the planets in their orbits, and we said gravity controls the orbit of the planets, are we being “arrogant” to say that it’s all gravity? The science – whether we’re talking about evolution or planetary orbits – works well. I realize you are laboring under some bad information that leads you to think otherwise, but we’re plenty willing to help rectify these gaps in your knowledge.
In the end, I think you’re reduced to harping on the abiogenesis problem. The genetic evidence that common descent occurred is strong, and I don’t think you can reasonably deny it. I also think you’ve lost the battle to claim evolutionary mechanisms can’t produce information needed to shape species on a macroevolutionary scale. But then, it appears that you have some unusual definition of information. And again: please define “information”.
You’ve made some interesting distinctions between fields of study. And I do not really disagree with the position that Intelligent Design/Creation (which, by the way, are not the same thing, as I believe one of the previous posts indicated) should not be taught in the science classroom, however I do not believe that evolution should be taught, either (and when I refer to evolution, I mean the theory of evoultion, not the more general definition of change over time.)
The problem is drawing the line between fields of study, as they necessarily overlap in many respects. While there is arguably some place in the study of science for origin theories such as the Big Bang, Evolution, and Intelligent Design, I do not believe that place is in the “science classroom” of pre-college education. Your arguments against teaching Intelligent Design in the “science classroom” can similarly be applied to evolution with the same result. In actuality, Evolution vs. Creation is a historical question which can be examined and better understood using science. Consider that the scientific method involves observability, testability, repeatability, and falsifiability. Evolution, as it pertains to origins, is not observable, not testable, not repeatable, and not falsifiable (I challenge you to consider what would prove evolution false – for instance, if I drop an apple and it travels away from the earth, it would disprove the theory of gravity.)
This also highlights the difference between the label of a “scientific theory” as it pertains to, say, gravity, and to evolution. The theory of gravity involves a scientific explanation for what we can observe, test, repeat, and falsify. The theory of evolution does not. (Gravity and Relativity were referred to in a previous post to demonstrate the weight that should be applied to the theory of evolution, however the clear distinctions I just discussed were ignored.)
Historically, there is a great deal of support for the Biblical account of creation. I choose not to include any citations here, but suffice to say that the Bible’s account of various historical facts has been shown to be reliable, and therefore it is a historical document that should be considered with examining the creation/evolution question. You have brought up several scientific observations that, while you may claim “prove” evolution, only -if anything- are consistent with the theory of evolution. They are also consistent with creation. For instance, the Vitamin C genetic “defect” you bring up and the similarities in the genome, while I do not claim to adopt the conclusions of the observations made relative to these subjects, I can point out that they are both consistent with Creation. Natural selection, which is a label used to describe an observation (and is often confused with evolution,) is also consistent with Creation.
As far as the fossil record is concerned, it has been well-studied and documented by creationist organizations that the observations made regarding the fossil record are equally consistent, if not more consistent, with a historical world-wide flood. Now, you may dismiss such an event as mythical and unreasonable, and you would be in good company, but you are still making an assumption that is contrary to some historical evidence (again, for one source see the Bible) and are therefore necessarily dismissing some evidence, perhaps unwisely.
In previous posts, the question “how did life arise?” was addressed, but I feel inadequately. While you tell a very nice story about proteins spontaneously arising and forming into a “simple” organism, I can tell a better story from Genesis that is also possible and historically documented. You do not cite any study, experiment, or observation that supports your allegation, and I would caution you that if laboratories have yet to simulate the creation of life in a controlled setting (based on so-called early earth conditions that are no more than assumptions), I find it extremely unlikely that life ever arose due to natural conditions with no divine creation.
May the Lord Jesus be with you all. I enjoyed reading your debate.
Well, I’ll be gone this week, so don’t expect a response from me anytime soon. Just a few notes before I go:
Consider that the scientific method involves observability, testability, repeatability, and falsifiability. Evolution, as it pertains to origins, is not observable, not testable, not repeatable, and not falsifiable (I challenge you to consider what would prove evolution false – for instance, if I drop an apple and it travels away from the earth, it would disprove the theory of gravity.)
Actually, I had been planning on writing a large (probably multi-part) article entitled something like “100 ways to prove evolution false”. It would detail a large variety of ways evolution could, theoretically, be proven false. Off the top of my head, I recall the argument made in the late 1800s. Someone had calculated the cooling rate of the earth’s interior and determined that it could be no older than 20 million years based on its current temperature. This was a real problem for evolutionists. The problem has since been swept away by the discovery of radioactivity, which adds heat to the planet. The calculation had assumed that no sources of new heat existed. So, no I disagree with the idea that evolution, as it pertains to origins, cannot be disproven. If evolution is false, then it’s the luckiest theory on the planet for consistently dodging bullets that had the potential to kill it. On that subject, I should probably link to this article I wrote detailing the radionuclides on earth, and how, if the earth is young, then it’s a phenomenal coincidence that all these tests come out consistent with an old earth.
Historically, there is a great deal of support for the Biblical account of creation. I choose not to include any citations here, but suffice to say that the Bible’s account of various historical facts has been shown to be reliable, and therefore it is a historical document that should be considered with examining the creation/evolution question.
Yes, I’ve looked at them. In fact, I’ve been doing occasional posts that review Strobel’s “The Case for Faith” which makes a lot of these arguments. You might be interested in my post where I compare Biblical History with Archeology.
You have brought up several scientific observations that, while you may claim “prove” evolution, only -if anything- are consistent with the theory of evolution.
No, no, I never used the word “prove”. In fact, I think I pointed out in my most recent comment that science doesn’t deal in “proof” – that’s a popular misconception. You’re right, it’s consistent with evolution and difficult to explain without invoking common descent (which conflicts with the special creation of mankind). I’ve seen creationists try to explain it, but it’s ugly to watch because they don’t have a case. I would also add that *all* scientific tests are used simply to determine whether the results are consistent with the theory. If I drop a ball and it falls to the earth at 9.8m/(second^2), does that prove gravity is true? No, rather, the ball’s downward trajectory is *consistent* with gravity. Neither of us can prove gravity made it move. Neither of us can prove that invisible angels or the flying spaghetti monster’s tentacles weren’t moving the ball towards the earth at a rate consistent with our gravitational predictions. To claim that I think it “proves” evolution is pushing me into an exaggerated position which, in turn, makes it easy to dismiss the whole idea entirely. It reminds me of a phrase I heard a long time ago: “the quickest way to lose an argument is to overstate your position”. I think the corollary to that statement is this: the quickest way to make your opponent lose an argument is to overstate his position (assuming, of course, he doesn’t rectify the situation).
They are also consistent with creation.
Only in a Last Thursdayism kind of a way. You have to remember the philosophical position of Creationism: you have an all-powerful God who can do anything. This means everything that could theoretically exist, is “consistent” with creation. Can you think of anything which God could not create? At best, we can argue that God wouldn’t create it. I would argue that God *wouldn’t* create an identical genetic defect in species, and if we assume He did, then why do it in a way consistent with common descent? Ultimately, the idea starts to sound suspiciously like “God buried fossils in the ground to test our faith”.
As far as the fossil record is concerned, it has been well-studied and documented by creationist organizations that the observations made regarding the fossil record are equally consistent, if not more consistent, with a historical world-wide flood.
No, I don’t believe that’s true at all, although there are a lot of people “defending their faith” and making money by making that claim.
Now, you may dismiss such an event as mythical and unreasonable
Not at all. I dismiss the event as a-historical and lacking evidence – not to mention in conflict with archeology.
My sixth grade teacher was a very wise man. Some 60 years later, I still remember what he taught us. He told us he was required to present the theory of evolution that says man came from monkey, but he also said, ” The Bible says God created man in His own image and no man can make me believe that my God looks like a monkey!”
Also, I have always wondered, if man evolved from monkey, why are there still monkeys? Or, if man evolved from a fish, why are there still fish? Or, if man evolved from an amoeba, why are there still amoeba? They all live on the same planet, so why didn’t all of them evolve?????
Those who believe in intelligent design give only one source of creation – God. The distinguished scientists seem to have many sources from which they believe we first evolved.
AnotherCreationist,
First off, I think I just throw up in my mouth a little bit after reading your post…Really? Really!? You are going to use the bible as a source? Seriously? The historical accuracy of most parts of the bible has been suspect for quite some time, and I have seen studies that have shown areas where the bible disagrees with other written materials of the same time meant to be historical texts. As for your flood story, every religion based in that area of the world has a flood story, not just judaism and christianity. The reason for this is that there was a rather significant flood in that area (as is proved by recent archaeological expeditions) and every different religious group tried to explain something that to them was unexplainable through their gods and goddesses. Religion is just a way to explain things outside of our understanding, which is why as science has stepped up more and more god get credit for less and less.
As for your argument that evolution shouldn’t be taught in schools…How do you suggest we go about explaining our origins? The reason why creationism (and yes creationism is the same thing as intelligent design. Originally the idea of creationism was shunned by academia because everyone knew it was religiously motivated, so they went back and changed the word creationism to intelligent design and made the wording more vague but it is literally the same theory) should not be taught in schools is because it is religiously motivated and we are not supposed to have any sort of religion in state institutions. Even if you argue that it doesn’t imply any certain god it still implies a god which is discriminatory towards atheists and agnostics.
DaveC,
Could you tell me if you were taught evolution in school? I wasn’t, nor was my family nor my parents.
Please point to one of the “many” instances of spontaneious ID. I still don;t know of any.
Are you referring to Fatima or Bernadette of Lourdes?
Also Nova had a two part special about “Intelligent Design. on Trial”. It was very interesing. Several creationists chose to not take the stand.
Anoither point, recently another fossil of the Archaeopteryx.
It’s one of those million year old dinosaur/bird evolution fossils you say doesn’t prove anyting. There are now ten of such fossils.
If there is ID, who or what created it?
What do the fossils represent to you? Do you think they’re a hoax? If birds didn’t evolve from such an animal, who went to the trouble of so elaborative a joke as making one up, hiding it, digging it up falcifing the data pertaining to age…?
My belief in evolution works with ID. Take for example the many varieties of horses, cats and dogs we have.
Human intellige/ design makes/made choices while working and making observations about animals. Humans choose to do selective breeding that lead to specialized breeds.
Huskies are not Poodles, who are not Chiuauas or St. Bernards. They’re all dogs but intelligent designers made choices for their breeding to get the traits for hunting, size, speed strength. These breeds are no accident. Their offspriing resulted ifrom a repeatable, varifiable reactions as a result of hunman intervention. Such changes evolve within the life time of most humans to see the truth of it.
We’ve done that with horses, cats, flowers, cattle, corn, etc.
Our cars have evolved and sprung from the mind of man as have airplanes and phones and thousands of other things.
We take technology for granted and use the scientific principals to get what we want. So machines not thought of alive or sentient, still exsist and evolve through our actions and thoughts.
Human ID which is not soley human ihas an arugement for both an ID and scientific evolution of millions of years.
Carl Sagan did fill in a vat with all the chemicals that exsist in the body of an average man and stirred them.
They did not spontanously form a man, but then he didn’t put on the dial for a timed baking period either.
He said ultimately that science and theology ask the same questions, who are we and why are we?
Dustin R.
No, I didn’t take PHIL 101, but I am pretty sure I would have got out of the 3rd grade if I hadn’t got drafted. I understand that there is no test that you could run to prove that God exists. The reverse of that is also true, the atheist cannot prove that he doesn’t exist. Denial by either side does not change reality. I also understand, that, by definition, natural sciences only seeks natural or materialistic causes. But no scientist has to presuppose God to detect design. And in fact, they detect it all the time, they just call it apparent design, which is an unwarranted assumption. Nor are they required to attribute design to God. Since evolution and random chance explains everything, maybe the intelligence was created with the big bang and built into nature. Who knows? The fact that many ID proponents may presuppose that the designer is God, does not alter whether or not the universe displays evidence of design. I won’t take the time to discuss your syllogism, because it is yours, not mine. I’ll get back to science, but first a few comments about God and philosophy.
Consider, if God does exist, there are two ways we might arrive at that conclusion. The first is, by revelation. The other is, by reasoning (Although René Descartes argued it would have been impossible for the human mind to invent God or the concept of infinity). Now I am not claiming our reasoning that there is a God would prove that He exist, any more than an atheist reasoning that there is no God would prove he doesn’t exist. But, if God does not exist, then obviously he could not have revealed himself, so he is a product of human reasoning, either that or Richard Dawkins’ space aliens. But then, where would they get the idea? At some point the idea of God entered into human thought. Even though some philosophical thought is involved, so would there had to have been some observations (science if you will) for man to come to that conclusion on his own. Besides, I do not believe you can completely divorce science from philosophy.
Your statement about “if someone came up with a new theory on our origins that was stronger than evolution . . . it would be accepted as the mainstream idea” doesn’t deserve a comment, but I’ll comment anyway. Fundamentally, there are only three possibilities, unless you want to include it all started from absolutely (not almost) nothing.
1 Both mind and matter existed in the beginning, I believe it was called Dualism, but haven’t read anything about it in a long, long time, because it has pretty much been discarded. As I recall, because it had all the problems of the other two.
2 Only matter existed, and mind is a product of matter.
3 Only mind (intelligence) existed and it created matter.
Given these options, unless someone wanted to revive no. 1, we are left with either naturalistic or supernatural first causes.
Your statement that the theory of gravity is taught as fact even though it is only a theory is patently false. In science there are hypothesis, models, theories and laws. There may be others in the hierarchy, as I am working from memory at the moment. Anyway, laws are established by theory and experimental evidence. A law has no known exceptions. If an exception is discovered, then it is no longer a law. If evolution had no known exceptions, it would be a law, but in the case of macro-evolution, it has no known occurrences, and doesn’t even really deserve to be called a theory, much less taught as fact. Now that you understand what a law of science is let’s look at one: (I was going to list several and provide a few comments, but this is getting longer than I intended.)
1. The Law of Biogenesis (only life begets life). Evolutionist don’t refer to it much anymore, and if they do they try to weaken the effect by calling it something else, a principle maybe. But is still a valid law of science, there are no known exceptions. Until this law is overturned, evolution theory is dead in the water. Yes, evolutionist have tried to distance themselves from the Law of Biogenesis, but, in the words of evolutionist geneticist Theodosius Dobzhansky; “Evolution comprises all the states of development of the universe; the cosmic, biological, and human or cultural developments. Attempts to restrict the concept of evolution to biology are gratuitous. Life is a product of the evolution of inorganic matter, and man is a product of the evolution of life.”
Dobzhansky, Theodosius (1967), Changing Man,. Science, 155:409, January 27.
Trilobite you say. An ancient, simple creature with one of the most highly developed optical systems known to man. Writing in Science News, Lisa Shawver wrote that trilobites possessed “the most sophisticated eye lenses ever produced by nature” [Shawver, Lisa J. (1974), Trilobite Eyes: An Impressive Feat of Early Evolution, Science News, 105:72, February]. Must have been a case of punctuated equilibrium to have that degree of “apparent design” at that early stage in evolutionary development.
As far as the fossil record support of evolution, apparently Richard Dawkins and some other evolutionist weren’t completely convinced, as evidenced by the following quotes regarding the Cambrian explosion
“The Cambrian strata of rocks, vintage about 600 million years [evolutionists are now dating the beginning of the Cambrian at about 530 million years], are the oldest in which we find most of the major invertebrate groups. And we find many of them already in an advanced state of evolution, the very first time they appear. It is as though they were just planted there, without any evolutionary history. Needless to say, this appearance of sudden planting has delighted creationists.” ( Dawkins, Richard (1986), The Blind Watchmaker (New York: W.W. Norton). p. 229, bracketed comment in orig., emp. added).
“. . . evolutionary biology’s deepest paradox”. Jeffrey S. Levinton, The Big Bang of Animal Evolution, Scientific American 267 (November, 1992, p. 84)
“The Cambrian explosion was the most remarkable and puzzling event in the history of life” Gould, Stephen J. (1994) “The evolution of life on earth,” Scientific American, 271: October, 1994, p. 86)
I know, the above quotes are little out dated, and there have been all sorts of new discoveries that all amount to the same thing. I still read about every new discovery that comes to my attention, but I quit hunting for them. There are so many anomalies in the fossil record from an evolutionary point, that maybe the fossils that do support it should be considered the anomalies.
I could also provide quotes from the late evolutionist fossil expert Colin Patterson, that after 20-years, he could not name one thing he knew about evolution (but he was still an evolutionist), but you can find it at http://www.ApologeticsPress.org under 15 Answers to John Rennie and Scientific American’s Nonsense. He also stated there was not one transitional form for which you could make an airtight case (I would have to look this one up). Again, this was several years ago, but evolutionist were commonly claiming transitional forms then just as they do today. Many of these fossils are assembled from the barest evidence and require a great deal of imagination. One exception is archaeopteryx, which was at least an almost complete fossil. But there are evolutionist who say it was only a bird, an ancient bird, but still a bird. Of course those are probably the dumb evolutionist. Where is the proof when even people who want to believe in evolution can’t agree. Proof is proof, Facts are facts, and guesswork is guesswork. Evolution is long on guesswork and short on facts. The fossil record might produce some evidence that could be construed in favor of evolution, but it also has a lot that could be construed against it, and it certainly cannot establish it as a fact of science, much less a law of science.
DCave:
Your statement that the theory of gravity is taught as fact even though it is only a theory is patently false. In science there are hypothesis, models, theories and laws. There may be others in the hierarchy, as I am working from memory at the moment. Anyway, laws are established by theory and experimental evidence. A law has no known exceptions. If an exception is discovered, then it is no longer a law. If evolution had no known exceptions, it would be a law…
I don’t have time to go through all your claims yet, but I should point out that you misunderstand the terms “law” and “theory”. Theories don’t “graduate” to become laws.
Some reading on that subject (I’m quoting them, but the articles should be read in their entirety; I’m just quoting them to give you a hint about what they contain):
A law simply summarizes observations. For example, the gas laws: http://en.wikipedia.org/wiki/Gas_laws . Like gravity, they are written as formulas – they describe how variables are observed to behave. You could essentially say that hypothesis are educated guesses about how things might behave. Laws are simple observations about how things do behave (without a deep understanding about why they behave that way). Theories are the marriage of hypothesis and observation (which validate the hypothesis).
DCave,
Seriously man, I can’t even read your posts anymore. The ignorance of basic scientific method and theory drips off it like grease from a fast food burger. And your little charade of pretending you don’t believe in creationism for religious reasons is just a blatant lie. I want you to tell me that you aren’t christian–and I want it to be true. I have never heard of a creationist (at least none that want people to think they base their ideas off of science) who isn’t christian. If I could find one then I might think that there was something more to the idea than people getting mad because science disagrees with their fairy tale book. But as it stands the only people who believe in creationism as some kind of scientific theory are christians which is either a statistical oddity or evidence that it is a religious belief which is inherently unscientific. You do not understand scientific method, nor do you realize how the scientific community operates. Not only that but you refuse to acknowledge this because it would prove that creationism is unscientific and end your petty argument. I’m going to stop replying to you know because I feel as though I’m playing a game of basketball with someone who looks at the rules as flexible while I realize they are necessary to play the game correctly. Or even more accurately it’s more like I’m trying to play basketball and instead you have decided to play tennis on the same court.
As far as the fossil record support of evolution, apparently Richard Dawkins and some other evolutionist weren’t completely convinced, as evidenced by the following quotes regarding the Cambrian explosion
No, this was quote-mined to make it appear that Dawkins “[wasn't] completely convinced”. A quick search in Amazon.com allows me to put Dawkin’s quote in context:
In fact, this is the view among evolutionists. More reading on the Cambrian here:
http://scienceblogs.com/pharyngula/2006/11/the_cambrian_as_an_evolutionar.php
And you can see Dawkin’s addressing this quote-mining here:
Nah – you’re just buying into the creationist’ myth about it. It’s my guess that Colin Patterson’s quote was about being able to prove ancestry. That’s a tricky thing to do. For a long time, it wasn’t known whether Neanderthals were humans’ parent species, or a cousin species. The problem is that evolution causes organisms to branch into species, and figuring out whether (say) Neanderthals were a parent species to humanity, or a cousin species is difficult because in both cases, they would have lots and lots of similarities. Was archaeopteryx the ancestor to modern birds? Or was it merely a cousin species to birds’ true ancestor? Those are tricky questions, and it can’t be answered absolutely. But, to say that we don’t *know* archaeopteryx *was* a parent species versus a side-branch that was an evolutionary dead-end isn’t that relevant. It’s played up as if “unless you *know* absolutely, then you know nothing”, which is a complete fallacy. There is information on the internet about how Patterson’s words have been twisted, you know. Here’s some information (from Patterson himself) that validates everything I was saying in this paragraph: http://www.talkorigins.org/faqs/patterson.html
There is a lot of information around about creationists twisting people’s words (also known as lying) to make evolutionists appear to say things they never said: http://www.talkorigins.org/faqs/quotes/mine/project.html
It might also be enlightening for you to discover that creationists aren’t always being honest – and that’s not really their goal, when you think about it. Their goal is to convince people that their God exists. Lying or twisting about the facts is done in “service” of a much larger goal. I could quote Michael Behe on that topic (and he’s among the more legitimate creationists among the bunch): “The danger to Christians from osmosing alien, materialistic presumptions, I think, far outweighs the danger of being wrong about any particular scientific point.” Behe is arguing that reinforcing theistic beliefs are far more important than accurate science.
Getting information from creationists, again? “Trilobites” represents over 10,000 different species over a span of 300 million years. If you’re going to talk about trilobites, you should at least identify whether you’re talking about early or late trilobites. Not all Trilobites had the correct structure that would give them a good visual depth of field.
I have a law called “the law of I can’t win the lottery jackpot”. It’s never been violated, and therefore, I conclude that it is impossible for me to win. It’s a law, and there are no known exceptions. Anyway, I provided you with links to my earlier article on abiogenesis – though, it seems you didn’t read them. I don’t really think you’re that interested in reading anything, just trying to convince me that evolution can’t work. Believe me – I’m familiar with everything you’re saying, and it’s either (A) completely wrong – like your hypothesis/theory/law argument, or (B) relies on misunderstanding or skewing the facts to fit a preconceived creationist perspective. I don’t really feel that anything I do or say can convince you otherwise, so I’m getting tired of the run-around.
Hi webmaster!
tinyfrog
So there are Christians who subscribe to evolution based on the evidence. So what. There are evolutionist who are not Christians that believe evolution must be directed based on the evidence. Evolution has been the standard teaching in schools for 40 or 50 years. I know because my oldest son is 45 and they were teaching it to him as fact in grade school, and to me in high school in the 50′s. They did not have the facts then and they do not have them today.
As far as Christian’s quoting the Bible in opposition to evolution, I believe that makes sense if you are arguing from a theological position. I do not believe it is appropriate to make the statement “That’s not what the Bible says” in a scientific discussion. I also notice that it is often the evolutionist, not the creationist that brings religion into the discussion. Sometimes it is used as an excuse to stop all discourse. Other times, they probably see it as to their advantage to use Christian evolutionist as useful idiots (I didn’t say they were idiots). But those theistic evolutionist better not be so bold as to try to publish papers in scientific journals supporting intelligent design or suggesting that God created life.
You are right, I have talked a lot about biogenesis, because, whether life started here on earth or was brought here by aliens it still had to originate somewhere. Since you say it isn’t part of evolutionist theory are you willing to concede that God created it? I didn’t think so.
The idea that science somehow has to pretend there is no God appears to be a fairly recent phenomenon. Newton, for example, believed that science should be used to help us better understand God. As I recall, he was no scientific slouch, even if at least one of his theories needed a little refinement. So whether you agree with Newton’s theology or not, you cannot dismiss his scientific accomplishments. I believe the attitude expressed in the following quote is irrational: ‘Even if all the data point to an intelligent designer, such an hypothesis is excluded from science because it is not naturalistic.’ Todd, S.C., correspondence to Nature 401(6752);423, 30 Sept. 1999. If all the evidence pointed to an intelligent designer, I believe it would be reasonable to at least consider that as a possible explanation.
I realize that you said it doesn’t matter to you what “prominent evolutionist” have said. Im pretty sure what some prominent creationist has said wouldn’t cut any ice with you, so I prefer to quote evolutionist. Whether you care or not, I believe the fact that evolutionist cannot even convince their own of some of their extravagant claims presents compelling evidence that those claims are greatly exaggerated. As far as me defending what “prominent theologians” have said, I would only feel compelled to do so it I thought they were right. The only person that speaks for me in theologic matters is me.
Back to the Lewontin quote, you still cannot make it say what it doesn’t say. He talks about the tolerance of the scientific community for unsubstantiated just-so stories, a prior commitment to materialism, science does not compel acceptance of a material explanation, we are forced by our a priori adherence to material causes to a set of concepts that produce material explanations, and that materialism is an absolute. In other words, we are going to look for material causes no matter where the evidence leads. Not a word about wave-particle duality. I do not read it that we should reject lots of modern science. I do believe we should reject “just-so stories” (Lewontin isn’t the only evolutionist to refer to them), human ancestors constructed from a few fragments of bone and vivid imaginations (same goes for whales), fourteen (or whatever the current number is) different versions of horse evolution and on and on it goes. So we agree on planetary orbits and gravity, which are observable and testable. The only evolution that has been observed is variation within kind (micro-evolution), but nobody has ever observed macro-evolution. All the observable evidence on real life animals with real life experiments is that there are limits beyond which you cannot go. Breeders have been able to develop dogs from chihuahuas to great Danes, but they are still dogs. After countless thousands of experiments on simple (biologically speaking) fruit-flys where mutations should have the greatest effect, geneticist have developed fruit-flies with an extra set of useless wings, and snooty fruit-flies that won’t breed with other fruit-flies, but much to their chagrin they are still fruit-flies. You can only push the genetic variation built into almost all living organisms so far before you run into a stonewall. If evolutionist had the evidence they claim, it would have been totally unnecessary for Stephen Jay Gould, among others, to revive a modified version of Goldschmidt’s hopeful monster (punctuated equilibrium).
When a dedicated evolutionist such as Dr. Colin Patterson can wake up one morning and realize that after 20-years of studying evolution that there was not one thing he knew about it, that should at least cause us to wonder if the hypothesis is all its cracked up to be. When he can pose that question to the geology staff at the Field Museum of Natural History and get only silence, what does that say about the soundness of the evolutionist position. When he tries it on the Evolutionary Morphology Seminar at the University of Chicago and the only response is, “I do know one thing, it ought not to be taught in high school”, is it any wonder that some of us wacky creationist refuse to take evolutionist word that it is an established fact. (See 15 Answers to John Rennie and Scientific American’s Nonsense at http://www.ApologeticsPress.org for full quotes citing references). Yes, its been a few years since the now deceased Dr. Patterson made those remarks, and I am not implying he became a creationist because I don’t know. But even back then when apparently a good number of credible evolutionist could not point to one thing they actually knew to be true, it was still being presented as fact. As far as I can tell, things haven’t changed much in the interim. So pardon me if I don’t jump on the bandwagon.
When I refer to information, I am talking about the genetic code. A quaternary code that is thought to be optimal from an engineering standpoint (ain’t it wonderful what blind chance can do?). I am acquainted with Shannon’s theory, but that is about as far as it goes. I did not say beneficial mutations are not information. What I am saying, and many biologist on both sides of the aisle agree, they do not provide any new information that would propel evolutionary change, i.e., changing a porcupine into a pig (just for example). Purely beneficial mutations are rare if they exist at all. They generally are beneficial within a certain setting, but harmful if conditions change. There is no free lunch.
You say, “Random mutations occur. Random mutations will (according to probability), hit on beneficial changes.” Here are what some prominent evolutionist have said about random mutations (I know, you don’t care, but somebody might):
“Some contemporary biologists, as soon as they observe a mutation, talk about evolution. They are implicitly supporting the following syllogism (argument): mutations are the only evolutionary variations, all living beings undergo mutations, therefore all living beings evolve. This logical scheme is, however unacceptable: first, because its major premise is neither obvious nor general; second, because its conclusion does not agree with the facts. No matter how numerous they may be, mutations do not produce any kind of evolution…. The opportune appearance of mutations permitting animals and plants to meet their needs seems hard to believe. Yet the Darwinian theory is even more demanding: a single plant, a single animal would require thousands and thousands of lucky, appropriate events. Thus, miracles would become the rule: events with an infinitesimal probability could not fail to occur…. There is no law against day dreaming, but science must not indulge in it.” Grassé, Pierre-Paul (1977), The Evolution of Living Organisms, pp. 88, 103, (New York: Academic Press).
“A mutation doesn’t produce major new raw material. You don’t make a new species by mutating the species…. That’s a common idea people have; that evolution is due to random mutations. A mutation is not the cause of evolutionary change”. Gould, Stephen J. “Is a New and General Theory of Evolution Emerging?,” Hobart College speech, 2-14-80; quoted in Luther Sunderland (1984), Darwin’s Enigma (San Diego, CA: Master Books).
Actually, mutations of any kind are rare, and beneficial mutations are exceedingly rare. How rare? Hermann J. Muller, Nobel laureate in genetics, said: “Accordingly, the great majority of mutations, certainly well over 99%, are harmful in some way, as is to be expected of the effects of accidental occurrences.” Well over 99% are harmful, that doesn’t leave much for beneficial ones. Then consider how unlikely it is for two random mutations to occur that would ‘push evolution’ in the same direction, and you are really talking ‘fairy tale for grownups”. You brought up probabilities, but if you are looking for support for evolution through probabilities you won’t find it. Most evolutionist shy away from probabilities like you would shy away from the plague. Either that, dismiss them, or put out faulty computer programs with a target, whereas random mutations do not have a target.
Some of the posts you gave I had already read, some I haven’t. They are still the same old thing, guesses presented as science. As far as I am concerned, evolutionist have cried wolf too often for me to get excited. Doesn’t mean I won’t look at my leisure, but I am not going to get in a sweat about it. Since almost all living things, whether plant or animal, are built from the same building blocks, it should not be surprising that they share some defects in common. After all they had a common designer.
You keep talking about random mutations. I have already quoted some “prominent evolutionist” on this subject, so I will quote a creationist; “If evolution from goo to you were true, we should expect to find countless information-adding mutations. But we have not even found one.” Sarfati, Jonathan (2002a), .15 Ways to Refute Materialistic Bigotry,. [On-line], URL: http://www.answersingenesis.org/news/scientific_american.asp.
I am not making it up that you cannot find one transitional form that all evolutionist agree on. All the ones that have been around long enough to be studied thoroughly have questions surrounding them.
You took issue with my statement that “Evolution predicts that the more two classes of animals resemble each other the more genes thy share, but often that is not true.” I didn’t state it very well, but it appears you are not in total disagreement. When you say I would be amazed at the incredible similarity of chimpanzee and human DNA, it appears that you are using that gene similarity as evidence of our “common ancestry”. I do know that geneticist have placed the similarity at least as high as 98.5%, but by recent reports that number is probably closer to 95, and may still come down some more. Even a 4-5% difference would result in about 200,000,000 differences between chimpanzees and humans. How many random mutations is that? Also, the chimpanzee genome is reportedly larger than the human, and humans have 46 chromosomes, whereas chimpanzee’s have 48. So according to evolution theory, which one is the most evolved? Remember before you answer, that it goes from simple to complex.
In older biology textbooks homologous structures were presented as being caused by similar genes. In fact, Darwin saw homology as strong evidence of his theory. When molecular biology came along, that upset the apple cart, because often homologous structures between classes were produced by different genes. Another evolution prediction bites the dust. Never, fear, they can always adjust the theory to make it fit. Actually, I never read about evolutionary predictions until after the fact.
You are going to have to provide a little more context for your Francis Crick quote. Saying “Nowadays we would have a more open mind about the nature of the first replicating system” does not imply one way or another whether he changed his views on the probability of abiogenesis.
The fossil record does not represent simple to complex, since practically all phyla known today, and some that are now extinct are represented in the Cambrian explosion. It isn’t from simple to complex, but from marine sessile (growing in place) to free swimming to terrestrial. This progression doesn’t represent when the organisms lived but where they lived.
Evolution is not well supported by the evidence, unless you believe blind chance can produce miracles. It is accepted on faith, and defended with all the fervor that some people have for religion. And is in fact a religion that dispenses with God.
I just remembered in another post which I don’t have time to look up, you mentioned random complex patterns produced at a Santa Fe lab. I believe the patterns you are talking about, as do mineral crystals and snowflakes merely repeat the same information multiple times. Some would refer to them as ordered, or lacking specified complexity (à la Dembski). At any rate they do not come remotely close to the complexity of even the simplest of biological organisms. The string AB AB AB AB AB AB AB AB is ordered, but carries little information or complexity. The same value repeated 8 times. The string SOC NEOW LANO BOE SKLVOSO NNE is complex but not ordered, and carries no useful information.
I know I probably have not responded to everything, but my time is limited, and I have just taken on a project that is going to keep me busy at least for a while. So everyone can breathe a big sigh of relief.
So there are Christians who subscribe to evolution based on the evidence. So what.
It means that your use of Lewontin to claim that the “scientific community” accepts evolution based on an a-priori commitment to materialism is *false*. Further, even staunch creationists concede that some aspects of evolution are true. Michael Behe concedes common descent of man and apes is true – even arguing the point in his book. So, why would a staunch, creationist author like Behe admit that common descent is true? Well, you he provides evidence that it *is* true. He’s not “hoodwinked” by the “establishment”, as much as creationists would like to believe it. The only reason more creationists don’t admit common ancestry is because they are ignorant of the facts, uncomfortable with the idea of human-chimp ancestry, or committed to a literal Biblical belief in the special creation of man. It really isn’t a defensible position in the context of modern biological/genetic knowledge.
There are evolutionist who are not Christians that believe evolution must be directed based on the evidence.
And I think think they’re wrong. After examining their claims, I think they’ve been confused by the science (usually because a theist propagated a misunderstanding), their arguments are flawed, and based on false analogies.
I also notice that it is often the evolutionist, not the creationist that brings religion into the discussion. Sometimes it is used as an excuse to stop all discourse.
(Shrug.) What does that have to do with me? It doesn’t look like you are accusing me of that, so it’s just a complaint about other people.
Since you say it isn’t part of evolutionist theory are you willing to concede that God created it? I didn’t think so.
No, I’m saying it’s a legitimate question to raise, but it’s a separate question of evolution over the past 3 billion years. In other words: you can’t disprove evolution over the last 3 billion years by arguing God created the first single-celled organism.
The idea that science somehow has to pretend there is no God appears to be a fairly recent phenomenon. Newton, for example, believed that science should be used to help us better understand God… I believe the attitude expressed in the following quote is irrational: ‘Even if all the data point to an intelligent designer, such an hypothesis is excluded from science because it is not naturalistic.’
If decent evidence can be produced for God, I’m willing to accept it. Unless some blatantly obvious evidence for divine intervention exists, I think the proper place of science is to stay silent in cases where no scientific/naturalistic explanation exists. The problem is that I don’t think this “blatantly obvious evidence” exists. I don’t think even decent evidence exists. There are some reasons to tread carefully when you consider injecting divine explanations into science: (1) many, many people rush to put God into any unexplained phenomena in order to justify their religious beliefs and make it serve an missionary purpose; many of these people are scientifically illiterate, involved in twisting the evidence, playing rhetorical games, or playing on society’s erroneous preconceived notions. This can turn bad very quickly. For example, Turkey allowed creationism to be taught in schools, and this, in turn, resulted in only creationism being taught in schools because most teachers were Muslim, and Harun Yahya became involved in a nasty slander campaign against professors teaching evolution. (2) Using divine explanations cut-off potentially fruitful areas of research. When you think phenomena X is caused by God, it prevents people from discovering naturalistic explanations for it. If you say that lightning or disease is caused by demons, it prevents real explanations from being discovered. (“all diseases of Christians are to be ascribed to demons” – Augustine) Neil DeGrasse Tyson has some commentary on this when he talks about how many great scientists of the past (he specifically talks about Newton, Huygens, etc) stopped discovering things whenever they inserted “God” as the explanation for phenomena. While I don’t think this completely bars divine explanations from science, it should make people very nervous about inserting God. Of course, science can remain silent when it doesn’t have explanations. I don’t think science needs to remain silent on origins because evolution does work. I can certainly understand Lewontin’s reason for the quote, and maybe you can too, when you think about these issues.
Then go back to my comment and read it again. The larger quote says, “Carl Sagan accepts, as I do, the duality of light, which is at the same time wave and particle”. He’s specifically mentions wave-particle duality, despite your assertion: “Not a word about wave-particle duality.”
I’ve already explained this.
I’ve already explained this and why he wasn’t saying what you think he was saying.
You’re not even sure that purely beneficial mutations can exist?
Uh huh. What exactly is the mathematical basis for saying that mutations + natural selection can’t get these mutations into species? You have none. But, I have a mathematical basis showing that it can produce beneficial mutations. There is a “free lunch”. Evolution is very capable of optimizing genes.
First of all, you NEED to realize that creationists are involved in quote-mining. I already talked about this in my last post. Quote-mining is the dishonest practice of taking evolutionists’ quotes out of context to make them appear to be saying something different than they actually said. You NEED to stop and realize that the information creationists are giving you is very often BAD. I will continue to hammer you on this point until you realize that creationists are being dishonest when they feed you these quotes. I don’t reject them because I don’t care what prominent evolutionists say, I reject them because I know creationists are being dishonest about these quotes. I would also add that the original Quote Book (a book of quote-mines by AnswersInGenesis) underwent substantial revision to become the Revised Quote Book after they discovered that many of their “quotes” were actually fabricated.
You quote Pierre-Paul Grassé as a “prominent evolutionist”, but he’s *not* an evolutionist. He’s a neo-lamarkian. He rejects neo-darwinism, so he cannot be used as an example of what a “prominent evolutionist” has said.
I believe Gould is talking about the importance of natural selection here. Mutations don’t create *major* new raw material. And mutations alone (without natural selection) would be disastrous because the accumulation of bad mutations would lead to extinction.
That’s obviously a false statement. Nearly one-third of all possible point-mutations would be silent mutations – i.e. they cause no change in the amino-acid sequence. Hence, the 99% number is most definitely false. But, then hey, Muller made that comment in 1950 – which was three years before we discovered that DNA is the hereditary molecule.
That’s your fiction, not reality.
If that’s your answer, you have failed to provide any decent answer. Are you saying your omniscient God is fallible? Are you saying that we know more than he did – since we discovered problems that He did not? This train of thought can only lead you to inconvenient conclusions.
Sarfati bloviates an awful lot. The creationist trick is this: anytime a new mutation is found, they claim it was always there. Nevermind that we can take a single bacteria in the laboratory, allow it to multiply (creating clones), and discover that some bacteria (due to mutations) have gained some beneficial genetic change that was not in the original parent. Some examples of beneficial mutations: Antibiotic resistance in bacteria, Bacteria that eat nylon, Lactose tolerance, Resistance to atherosclerosis, human Immunity to HIV, HIV immunity to anti-viral treatments…
http://www.talkorigins.org/faqs/mutations.html
In fact, there’s a quite a bit of research on lactose tolerance – it is a mutation that has occurred multiple times throughout the world (based on genetic studies), and it allows humans to digest milk into adulthood.
http://scienceblogs.com/loom/2007/02/26/in_the_footsteps_of_my_lactose.php
http://arstechnica.com/journals/science.ars/2006/12/11/6246
Evolutionists DO agree that claimed transitionals were closely related to the true transitionals. Was Tiktaalik actually in our ancestry, or was it merely a cousin species to our ancestors? Not all evolutionists will agree because we can’t answer that definitively due to the natural limitations of fossil evidence. Your argument sounds relevant, but it’s not really a big deal.
How many random mutations is that? A single insertion or deletion can account for a number of differences in a single event. So, That’s not 200 million mutation events. (And, by the way, humans and chimps have 3.2 billion base pairs. A “4-5%” difference would be 128-160 million differences.) According to this, the insertion-deletions tended to be small, although they did find some that were several hundred nucleotides in length, and one that was 4,263 nucleotides long. That’s one mutation event that contributes 4,263 changes.
And most of those mutations are in non-coding DNA (likely has no effect), and I’ve seen a number of mutations that are silent mutations. I only know of one case where human and chimpanzee versions of the same gene differs by more than 3%. In the case of cytochrome-C, human, chimpanzee, and gorilla versions produce the identical protein, but they differ in the genetic sequence because of a few silent mutations. Cytochrome-C comes in lots of different varieties in the animal world, and they are interchangeable. You can inject the human version into yeast, and it works perfectly well. My point is that a vast majority of genetic differences between humans and chimps are going to be neutral.
Yup. But, you have the details wrong again. You say that chimpanzees have 48 chromosomes and humans have 46. Then you *assume* this means chimpanzees have a larger genome than humans. That is wrong. The fact that you learned about the 46/48 chromosome difference from creationist websites, but they never actually told you about the facts should tell you something about the abysmal level of information creationists are giving you. The fact that they would omit the facts about this is ridiculous, and it should make you question their integrity when they fail to fully-disclose the facts. There was a fusion event in the human lineage (i.e. two chromosomes fused together to become a single chromosome). The fact that there are obvious telomeres in the middle of a human chromosome is a little bit of evidence that the human-ancestors once had 48 chromosomes – just like chimpanzees and gorillas. You should be counting this as evidence for common ancestry with apes.
I would also point out that the Apologetics Press website has some extremely ridiculous statements about this (1, 2). Example:
How dumb. It wouldn’t be “one-quarter human” even if 25% of the genome were identical. To think this is even an argument against evolution is depressingly stupid. Second, if one species had a genome of 1 million random nucleotides, and another species had 2 million random nucleotides, then we would expect a match of 12.5% (missing nucleotides are “misses”). I’m just shaking my head at their attempts to persuade the reader that high sequence similarity isn’t all that significant. I think I really need to show some actual genetic comparisons, because they’re playing games to mislead readers (and I’d guess they’d never seen a genetic sequence comparison in their whole lives).
And common sense would be wrong. Creationists always seem to rely on intuition rather than actual knowledge, which is a major part of the problem.
This quote was incredibly stupid:
Sorry, that quote is SO misinformed and stupid, it makes my brain hurt.
The Apologetics Press completely missed the point, and didn’t even address the relevant issue. Take a look at this picture. It shows a human, chimpanzee, gorilla, and orangutan chromosome right next to each other. Can you figure out what happened to the “missing” chromosomes? They fused together to become one chromosome. You see, on the ends of every chromosome are things called telomeres. They act sort of like caps on the ends to prevent damage to the chromosome. Also, chromosomes normally have one centromere in the middle of the chromosome. In the human version of chromosome #2, we find telomeres on the ends, but we also find some right in the middle of chromosome #2. Additionally, we have two centromeres on chromosome #2. This makes no sense unless you start with two separate chromosomes and fuse them together at the ends. Human ancestors had 48 chromosomes, just like all the other apes. The alternative theory: that God created us one chromosome where apes have two, and created telomeres in the middle of chromosome #2, and created two different centromeres on chromosome #2 makes no logical sense. Well, no logical sense if we assume God isn’t going out of his way to deceive us into thinking we’re related to apes.
Here’s a 4 minute Ken Miller video on the fusion of the human chromosome:
http://www.youtube.com/watch?v=zi8FfMBYCkk
This information was brought up at the Dover trial, and the “Intelligent Design” advocates never even attempted to dispute the evolutionary explanation. They had no rebuttal.
Sorry, you don’t understand evolutionary theory. First, the number of chromosomes has *nothing* to do with complexity, and the size of the genome is *not* any kind of measure of complexity. Second, evolution doesn’t predict life must be increasing in “complexity” (whatever that is, or however you measure it). There are many cases where evolution leads to a smaller genome, or the loss of genes. Species that change from independent organisms to parasites often lose genes. Tapeworms, for example, have done this. Because they can get various nutrients from their hosts, they no longer need all their old biochemical pathways (which allowed them to synthesize nutrients while living independently). Evolution is about survival and differential survival rates, not about an increase in complexity. In the far future, when the earth heats up due to the expansion of the sun, it will likely be the large multicellular organisms which die-off first. A billion years from now, the only living organisms might be tiny single-celled organisms. It’s about survival – not some unstoppable increase in complexity.
In fact, the genetics of tapeworms should lead you to a few conclusions. There are over a thousand species of tapeworms – each with their own genetics. Did your God create the tapeworms? They certainly aren’t capable of living a non-parasitic lifestyle anymore, and based on their genetic diversity, it’s been a long time since they’ve been capable of a non-parasitic lifestyle.
The rest of your post I’m just going to skip because it relies on your subtle misunderstandings of evolution and reality. I don’t feel like going out of my way to give you a complete remedial education — one that you will resist anyway.
[...] Rather than talking about the mechanisms of evolution, they chose, instead, to talk about the “evils of evolution”: show concentration camps and talk about Adolf “God with Us” Hitler – so they can emotionally inflame people, shutting down the thinking portions of their brains, rather than intellectually convert them. No doubt, they’ll avoid mentioning Martin “We are at fault in not slaying [the Jews]” Luther’s influence et wright battista oxford taupe Hitler – whom Hitler praised in his book, Mein Kampf. Meanwhile, Origin of the Species was banned in Nazi Germany. http://tinyfrog.wordpress.com/2007/08… [...]
Interesting facts.I have bookmarked this site. stephanazs
[...] Rather than talking about the mechanisms of evolution, they chose, instead, to talk about the “evils of evolution”: show concentration camps and talk about Adolf “God with Us” Hitler – so they can emotionally inflame people, shutting down the thinking portions of their brains, rather than intellectually convert them. No doubt, Oakley Glacier Freeze Jacket Womens avoid mentioning Martin “We are at fault in not slaying [the Jews]” Luther’s influence on Hitler – whom Hitler praised in his book, Mein Kampf. Meanwhile, Origin of the Species was banned in Nazi Germany. http://tinyfrog.wordpress.com/2007/08… [...]
[...] Rather than talking about the mechanisms of evolution, they chose, instead, to talk about the “evils of evolution”: show concentration camps and talk about Adolf “God with Us” Hitler – so they can emotionally inflame people, shutting down the thinking portions of their brains, rather than intellectually convert them. No doubt, they’ll avoid mentioning Martin “We are at fault in not slaying [the Jews]” Luther’s influence on Hitler – whom Hitler praised in his book, Mein Kampf. Meanwhile, Origin of the Species was banned in Nazi Germany. http://tinyfrog.wordpress.com/2007/08… [...]
Ben Stein is smart… Made
Richard Dawkins look like what he is ….
Hi I am so grateful I found your site, I really found you by
mistake, while I was browsing on Aol for something else, Regardless I am here now and
would just like to say cheers for a marvelous post
and a all round interesting blog (I also love the theme/design),
I dont have time to look over it all at the minute but
I have bookmarked it and also added your RSS feeds, so when I have time I will be back to read a lot more, Please do keep up the excellent work.
Check out my website to get more info about forex, if you like.